v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small Cajal body-specific RNA 7 (SCARNA7) secondary structure diagram

Homo sapiens (human) small Cajal body-specific RNA 7 (SCARNA7) URS00002B3204_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SCARNA7: SCARNA7 is a small nucleolar RNA (snoRNA) that has been identified as a potential marker for EGFR mutation status in patients with non-small cell lung cancer (NSCLC) [PMC6938758]. In a study analyzing the expression levels of long non-coding RNAs (lncRNAs) in the pleural effusions of NSCLC patients, SCARNA7, along with MALAT1 and NONHSAT017369, was evaluated as a prospective marker for EGFR mutation status [PMC6938758]. Additionally, within the sequence of W22.2, SCARNA7 was predicted as a snoRNA candidate [PMC8490949]. The study used qRT-PCR to detect the relative expression levels of SCARNA7 in pleural effusions and plasma samples from both EGFR-mutant and EGFR wild-type NSCLC patients [PMC6938758]. The findings suggest that pleural effusion may overcome tumor heterogeneity to some extent, making it a potential source for analyzing RNA expression levels in NSCLC patients [PMC6938758]. The identification of SCARNA7 as a potential marker for EGFR mutation status could have implications for personalized treatment approaches and prognosis prediction in NSCLC patients [PMC6938758]. Further research is needed to validate the utility of SCARNA7 and other lncRNAs as biomarkers in NSCLC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAAUGAUGAAAUAGAGAUAAUUGGGUGUUGAAUGUUGUAUGACUGGAAAUUUUUAAUAUGUAUAUUAUGUAAUUCUUAUAAGUUUAGUGUUUUAUAGGUACUUAAUAGAGAGUGUGUAUGCAUGUGUGUGUGCUUGUGGUGGCUAUGGAAAGGGGGCACUGACUGGUGAUGCUGAUAUUGGAGUGCAUCUGAGGCUGUUGUAGAAAUAACAUGGGUUGUUGAUUACAACAUUGCCAAUGAUUAUAACCCAAGAACAGCUCACCUAACUAGCCUGGCACCCUAAAAUCUCUAACAGGUUCAUUAAAAUGGUCCUGUGAUCUGAUCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications