Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-497-5p URS00002AE1D6_246437

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCACACUGUGGUUUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Bos taurus (cattle) bta-miR-497
  2. Cavia porcellus (domestic guinea pig) cpo-miR-497-5p
  3. Cervus elaphus (red deer) cel-miR-497
  4. Cricetulus griseus (Chinese hamster) cgr-miR-497-5p
  5. Homo sapiens Hsa-Mir-15-P1d_5p (mature (guide))
  6. Macaca mulatta Mml-Mir-15-P1d_5p (mature (guide))
  7. Microcebus murinus mmr-miR-497
  8. Mus musculus (house mouse) mmu-miR-497a-5p
  9. Oryctolagus cuniculus ocu-miR-497-5p
  10. Pan troglodytes ptr-miR-497
  11. Rattus norvegicus (Norway rat) rno-miR-497-5p
  12. Tursiops truncatus miR-497
Publications