Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Acanthoscelides obtectus hypothetical protein secondary structure diagram

Acanthoscelides obtectus hypothetical protein URS000029CCC5_200917

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 249 other species

  1. Acanthisitta chloris tRNA
  2. Acinetobacter baumannii tRNA-Phe
  3. Aethina tumida (Small hive beetle) transfer RNA phenylalanine (anticodon GAA)
  4. Agrilus planipennis tRNA-Phe
  5. Ailuropoda melanoleuca tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  6. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  7. Albula goreensis tRNA-Phe
  8. Alligator mississippiensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  9. Alligator sinensis tRNA
  10. Alosa alosa tRNA-Phe
  11. Amazona aestiva tRNA
  12. Ameiurus melas tRNA-Phe
  13. Amphimedon queenslandica tRNA-Phe
  14. Amyelois transitella (Naval orange worm) tRNA-Phe
  15. Anas platyrhynchos tRNA
  16. Anguilla anguilla tRNA-Phe
  17. Anolis carolinensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  18. Anthonomus grandis grandis (Boll weevil) transfer RNA phenylalanine (anticodon GAA)
  19. Aptenodytes forsteri tRNA
  20. Araneus ventricosus tRNA-Phe
  21. Aromia moschata tRNA-Phe
  22. Astyanax mexicanus tRNA
  23. Ataeniobius toweri tRNA-Phe
  24. Balaenoptera acutorostrata scammoni tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  25. Balearica regulorum gibbericeps tRNA
  26. Bicyclus anynana tRNA-Phe
  27. Biomphalaria glabrata (Bloodfluke planorb) tRNA tRNA-Phe
  28. Biomphalaria pfeifferi tRNA-Phe
  29. Blattella germanica tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 14)
  30. Bombyx mandarina (Wild silkworm) tRNA-Phe
  31. Bombyx mori tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  32. Bos taurus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  33. Caerostris darwini tRNA-Phe
  34. Caerostris extrusa tRNA-Phe
  35. Callipepla squamata tRNA
  36. Callithrix jacchus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  37. Callorhinchus milii tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  38. Callosobruchus analis hypothetical protein
  39. Callosobruchus chinensis hypothetical protein
  40. Calypte anna (Anna's hummingbird) tRNA
  41. Camelus ferus tRNA
  42. Canis lupus familiaris tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  43. Cariama cristata tRNA
  44. Carlito syrichta tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  45. Cathartes aura (turkey vulture) tRNA
  46. Cavia porcellus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  47. Centruroides sculpturatus tRNA-Phe
  48. Ceratotherium simum simum tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  49. Chaetura pelagica tRNA
  50. Characodon lateralis tRNA-Phe
  51. Charadrius vociferus tRNA
  52. Chelonia mydas (green seaturtle) tRNA
  53. Chelydra serpentina tRNA-Phe
  54. Chlamydotis macqueenii tRNA
  55. Chlorocebus sabaeus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  56. Choloepus hoffmanni tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  57. Chrysemys picta bellii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  58. Cimex lectularius tRNA-Phe
  59. Cinara cedri tRNA.Phe
  60. Colinus virginianus (northern bobwhite) tRNA
  61. Colius striatus tRNA
  62. Columba livia tRNA
  63. Cordylochernes scorpioides tRNA-Phe
  64. Corvus brachyrhynchos (American crow) tRNA
  65. Crenichthys baileyi tRNA-Phe
  66. Cricetulus griseus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  67. Cryptotermes secundus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  68. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA phenylalanine (anticodon GAA)
  69. Dallia pectoralis tRNA-Phe
  70. Danaus plexippus plexippus tRNA
  71. Danionella translucida tRNA-Phe
  72. Danio rerio tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 44)
  73. Daphnia galeata transfer RNA
  74. Daphnia magna tRNA-Phe
  75. Daphnia pulex tRNA-Phe for anticodon GAA
  76. Daphnia pulicaria (Water flea) tRNA-Phe
  77. Dasypus novemcinctus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  78. Dermacentor andersoni transfer RNA phenylalanine (anticodon GAA)
  79. Dermacentor silvarum transfer RNA phenylalanine (anticodon GAA)
  80. Diabrotica virgifera virgifera transfer RNA phenylalanine (anticodon GAA)
  81. Dicentrarchus labrax transfer RNA-Phe
  82. Dipodomys ordii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  83. Dryococelus australis tRNA-OTHER
  84. Echinops telfairi tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  85. Egretta garzetta tRNA
  86. Equus caballus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  87. Erinaceus europaeus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  88. Eschrichtius robustus tRNA-Phe
  89. Eumeta japonica tRNA-Phe
  90. Eurypyga helias (sunbittern) tRNA
  91. Exocentrus adspersus tRNA-Phe
  92. Felis catus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  93. Ficedula albicollis tRNA
  94. Fukomys damarensis (Damara mole-rat) tRNA
  95. Fulmarus glacialis tRNA
  96. Galendromus occidentalis (Western predatory mite) tRNA-Phe
  97. Galleria mellonella (Greater wax moth) tRNA-Phe
  98. Gallus gallus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  99. Gasterosteus aculeatus tRNA
  100. Gavia stellata tRNA
  101. Geospiza fortis tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  102. Gorilla gorilla gorilla tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  103. Haemaphysalis longicornis (Longhorned tick) tRNA-Phe for anticodon GAA
  104. Haliaeetus albicilla (white-tailed eagle) tRNA
  105. Heliconius melpomene (Postman butterfly) tRNA HMEL008167
  106. Helicoverpa armigera transfer RNA phenylalanine (anticodon GAA)
  107. Helicoverpa zea (Corn earworm) tRNA-Phe
  108. Heterocephalus glaber tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  109. Hippoglossus stenolepis (Pacific halibut) tRNA-Phe
  110. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Phe
  111. Homo sapiens tRNA-Phe (anticodon GAA) 1-1 (TRF-GAA1 1 to 6)
  112. Hyalomma asiaticum (Tick) tRNA-Phe for anticodon GAA
  113. Ictidomys tridecemlineatus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  114. Ixodes persulcatus tRNA-Phe for anticodon GAA
  115. Ixodes scapularis tRNA-Phe for anticodon GAA
  116. Lamprotornis superbus tRNA-OTHER
  117. Larimichthys crocea tRNA
  118. Latimeria chalumnae tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  119. Leguminivora glycinivorella (Soybean pod borer) tRNA-Phe
  120. Lepisosteus oculatus (spotted gar) tRNA
  121. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Phe
  122. Leptosomus discolor tRNA
  123. Limnoperna fortunei (Golden mussle) misc RNA ENSLFOG00000078462.1
  124. Lineus longissimus (Bootlace worm) misc RNA ENSLLNG00015023872.1
  125. Lonchura striata domestica (Bengalese finch) tRNA
  126. Lottia gigantea tRNA-Phe for anticodon GAA
  127. Loxodonta africana tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  128. Macaca mulatta tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1 3 to 7)
  129. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA phenylalanine (anticodon GAA)
  130. Manacus vitellinus tRNA
  131. Manduca sexta (Tobacco hornworm) tRNA-Phe
  132. Marmota monax (woodchuck) tRNA.Phe
  133. Megalops atlanticus (tarpon) tRNA-Phe
  134. Meleagris gallopavo tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 3)
  135. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023414.1
  136. Melopsittacus undulatus tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1, tRNA-Phe-GAA-1-2)
  137. Merluccius polli tRNA-Phe
  138. Mesocricetus auratus tRNA
  139. Microcebus murinus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  140. Mitosporidium daphniae tRNA
  141. Mizuhopecten yessoensis tRNA-Phe
  142. Molorchus minor tRNA-Phe
  143. Monodelphis domestica tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 9)
  144. Mus caroli tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  145. Mus musculus castaneus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  146. Mus musculus domesticus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  147. Mus musculus musculus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  148. Mus musculus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  149. Mus pahari tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  150. Mus spretus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  151. Mustela putorius furo tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  152. Myotis brandtii tRNA
  153. Myotis davidii tRNA
  154. Myotis lucifugus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  155. Neotoma lepida tRNA
  156. Nephila pilipes (giant wood spider) tRNA-Phe
  157. Nestor notabilis tRNA
  158. Nilaparvata lugens (Brown planthopper) tRNA-Phe
  159. Nipponia nippon (crested ibis) tRNA
  160. Nomascus leucogenys tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  161. Nothobranchius furzeri tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  162. Ochotona princeps tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  163. Octopus bimaculoides tRNA-Phe
  164. Octopus sinensis tRNA-Phe
  165. Ophiophagus hannah tRNA
  166. Opisthocomus hoazin tRNA
  167. Oreochromis niloticus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  168. Ornithorhynchus anatinus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  169. Oryctolagus cuniculus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  170. Oryzias latipes tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  171. Otolemur garnettii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  172. Ovis aries tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  173. Pangasianodon gigas (Mekong giant catfish) tRNA-Phe
  174. Pangasianodon hypophthalmus tRNA-Phe
  175. Pangasius djambal tRNA-Phe
  176. Pan troglodytes tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  177. Papilio machaon tRNA
  178. Papilio xuthus tRNA
  179. Papio anubis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  180. Pararge aegeria tRNA-Phe (GAA) (tRNA-Phe-GAA-1-1)
  181. Parasteatoda tepidariorum (Common house spider) tRNA-Phe
  182. Patagioenas fasciata monilis tRNA
  183. Patella pellucida (Blue-rayed limpet) misc RNA ENSDPLG00005026894.1
  184. Patella vulgata (Common limpet) misc RNA ENSPVUG00005026978.1
  185. Pectinophora gossypiella transfer RNA phenylalanine (anticodon GAA)
  186. Pediculus humanus corporis tRNA tRNA-Phe
  187. Pelobates cultripes (western spadefoot toad) tRNA.Phe
  188. Pelodiscus sinensis tRNA
  189. Perca flavescens tRNA-Phe
  190. Perca fluviatilis tRNA-Phe
  191. Phaethon lepturus tRNA
  192. Phrynosoma platyrhinos tRNA-OTHER
  193. Dryobates pubescens tRNA
  194. Pleuronectes platessa (European plaice) tRNA-Phe
  195. Podarcis lilfordi tRNA.Phe
  196. Poecilia formosa tRNA
  197. Pollicipes pollicipes tRNA-Phe
  198. Pomacea canaliculata (Apple snail) tRNA-Phe
  199. Pongo abelii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  200. Priapulus caudatus tRNA-Phe
  201. Procavia capensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  202. Pteropus alecto (black flying fox) tRNA
  203. Pygoscelis adeliae (Adelie penguin) tRNA
  204. Rattus norvegicus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  205. Rhipicephalus microplus tRNA-Phe
  206. Rhipicephalus sanguineus tRNA-Phe
  207. Rhodnius prolixus tRNA tRNA-Phe
  208. Saimiri boliviensis boliviensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 5)
  209. Salmo salar tRNA
  210. Sarcophilus harrisii tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  211. Schistocerca americana (American grasshopper) tRNA-Phe
  212. Schistocerca cancellata (South American locust) transfer RNA phenylalanine (anticodon GAA)
  213. Schistocerca gregaria (Grasshoppers) transfer RNA phenylalanine (anticodon GAA)
  214. Schistocerca nitens (Vagrant locust) transfer RNA phenylalanine (anticodon GAA)
  215. Schistocerca piceifrons (Central American locust) tRNA-Phe
  216. Schistocerca serialis cubense (Grasshoppers) transfer RNA phenylalanine (anticodon GAA)
  217. Scleropages formosus tRNA
  218. Sipha flava tRNA-Phe
  219. Sitophilus oryzae (Rice weevil) tRNA-Phe
  220. Sorex araneus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  221. Sphaerodactylus townsendi tRNA-Phe
  222. Spodoptera frugiperda tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 12)
  223. Stegodyphus dumicola tRNA-Phe
  224. Stegodyphus mimosarum (African social velvet spider) tRNA-Phe for anticodon GAA
  225. Struthio camelus australis tRNA
  226. Sus scrofa tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 7)
  227. Taeniopygia guttata tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  228. Takifugu rubripes tRNA-Phe (GAA) (tRNA-Phe-GAA-2 1 to 10)
  229. Tetraodon nigroviridis tRNA
  230. Tinamus guttatus tRNA
  231. Tribolium castaneum tRNA-Phe for anticodon GAA
  232. Trichechus manatus latirostris tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  233. Trichonephila clavata tRNA-Phe
  234. Trichonephila clavipes tRNA-Phe
  235. Trichonephila inaurata madagascariensis (Nephila madagascariensis) tRNA-Phe
  236. Tropilaelaps mercedesae tRNA
  237. Trypanosoma vivax Y486 tRNA
  238. Tupaia chinensis (Chinese tree shrew) tRNA
  239. Tursiops truncatus tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
  240. Tyto alba tRNA
  241. Varroa destructor (Honeybee mite) tRNA-Phe
  242. Varroa jacobsoni (Varroa mite) tRNA-Phe
  243. Vibrio parahaemolyticus tRNA-Phe
  244. Vicugna pacos tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 6)
  245. Xenopus laevis tRNA
  246. Xenopus tropicalis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 46)
  247. Xiphophorus maculatus tRNA
  248. Zerene cesonia (Southern Dogface) tRNA-Phe
  249. Zootermopsis nevadensis tRNA-Phe (GAA) (tRNA-Phe-GAA-1 1 to 4)
2D structure