Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-513b-5p URS0000284586_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-513b: Hsa-mir-513b is a microRNA that has been implicated in various biological processes and diseases [PMC8241782]. In a study, it was found that hsa-mir-513b, along with other miRNAs, may play a key role in regulating hub-genes in certain pathways [PMC8241782]. Another research identified hsa-mir-513b as one of the miRNAs that may be involved in regulating hub-genes and its high levels were associated with worse disease-free survival [PMC8241782]. Hsa-mir-513b was also found to potentially regulate the expression of CXCL8, along with other miRNAs [PMC8241782]. Additionally, hsa-mir-513b was found to have a potential regulatory effect on CXCL1 [PMC8241782]. Elevated levels of hsa-mir-513b were associated with worse disease-free survival [PMC8241782]. In the context of different diseases, hsa-mir-513b has been identified as one of the highly accurate miRNAs for diagnosing patients with nasopharyngeal carcinoma and intrahepatic cholangiocarcinoma [PMC9318750][PMC7257878]. Furthermore, hsa-mir-513b has been implicated in polycystic ovary syndrome and lung cancer [PMC4508762][PMC4826230]. In patients with membranous nephropathy, downregulation of hsa-mir-513b was observed [PMC8610666]. Overall, these studies highlight the potential role of hsa-mir-513b in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAAGGAGGUGUCAUUUAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-513b
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-513b
  3. Rhinopithecus bieti pbi-miR-513b
  4. Symphalangus syndactylus (siamang) ssy-miR-513b
Publications