Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR1428e-3p URS000027CC30_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR1428e-3p: Osa-mir1428e-3p is a rice-specific miRNA that is differentially expressed between the rice sheath resistant line YSBR1 and the susceptible line Xudao3 following inoculation with R. solani [PMC7867673]. It targets the gene OSK3, which encodes a carbon catabolite depressing protein kinase [PMC4683037]. Osa-mir1428e-3p is upregulated during seed imbibition and greatly induced by gibberellic acid (GA), while its target OSK3 is decreased during seed imbibition and insensitive to GA and abscisic acid (ABA) [PMC4683037]. GA displays an antagonistic role to ABA by upregulating the inhibitor of the positive regulator in ABA signaling, which includes osa-mir1428e-3p [PMC4683037]. The 5สน-RACE analysis confirms that osa-mir1428e-3p cleaves OSK3 mRNA at canonical cleavage sites [PMC4683037]. The expression pattern of osa-mir1428e-3p detected by qRT-PCR is consistent with sequencing data, indicating its differential expression between different conditions [PMC4448008]. During coleoptile senescence, osa-mir1428e-3p is highly upregulated along with other conserved miRNAs such as osa-miR394 and osa-miR396a-5p [PMC9597502]. Osa-mir1428e-3p targets multiple genes except for a few miRNAs that hit only a single target gene [PMC9597502]. In CS and FLS datasets, osa-mir1428e-3p displays an inverse expression pattern along with other miRNAs such as osa-miR160e-5p and osa-miR171h [PMC9597502].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGAUAAUGCCAUGAAUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group miR1428e_3p
Publications