v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DEPDC1 antisense RNA 1 (DEPDC1-AS1) URS0000271D9B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DEPDC1-AS1: DEPDC1-AS1 is a non-coding RNA that has been implicated in triple-negative breast cancer prognosis [PMC8913900]. A triple-length non-coding RNA risk scoring system was developed to predict the prognosis of triple-negative breast cancer, and DEPDC1-AS1 was included in this system [PMC8913900]. To investigate the impact of DEPDC1-AS1 on tumorigenesis in vivo, HGC-27 cells transfected with sh-DEPDC1-AS1 or an empty vector control were injected into nude mice [PMC9044790]. This study aimed to evaluate whether DEPDC1-AS1 could influence HGC-27 cell tumorigenesis in vivo [PMC9044790]. The results of this study could provide insights into the role of DEPDC1-AS1 in triple-negative breast cancer and its potential as a prognostic marker or therapeutic target. Further research is needed to fully understand the mechanisms by which DEPDC1-AS1 influences tumorigenesis and its potential clinical applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGGCACAGGAGUCGCUCCUCAUAGCGAGUCUGGUGCGGCCUACGCGCGGCGCUUCCUUUCGGACCUGAGGCCCAGACCCUCAAAAUAGAGGGAGCGGAUAAGGAAGUCAUAAUAUUAAUGAACUCUGAGGACUGCUAUGAGGAUAAAAUGGGAUCAUCAUCAUCAUCAUCAUCACUUACUCAAUGCGUACUACAAUCCUGGCACUCCUCUAAGUGUUACAAAUAUAUUAACUCCAACAAUAACUCCAGAAGAAAUCCUAGUAUUGCAUAAGUGAUCUUCAUGAAGCUUCCUAUUCCCUGUGGAGUUUGGAAGGAGAGGCAUUCCUGUAGGCUUCUGCUGAGAAGGGAAGAAGAGUCUUCCUGCUUGGACACUGGGCUUCUGAAAAGGCCAUGUGCUCUCCUAUCUCACAGUUUUCUUUCUUUUACUUUUUUUGUUUGUCUUUUUUCUCUUUUUUUAUUCUUUUUUUCUUACCUCACAGUCUUGUAUGUGUUUUGACUGUCACAAGAAUGAGCAUUGGACGUGGUAGAAAAAAUUCUUGGAUUAGUGCCUCUCAUUAGUCCCUAAAAAUACAUAUGUAUCUGGCCCCAACUCCUGGUGACUCUCUAAGCUUAUGAUGCAUUUUUUGGUAUGUUUUGUAUACAGUUUUGAGCUUCCGCAAUGAUUUUUAAAACAGGACAAAAUCCCAUAUGAACCUUCUGUUAUACUCCAUUAAAUUGUCAAUACCAGAGAUACAGGAAAAUUAUUUUCUCAUUCUAACUUUAUAUACCCAAUAUCUAACAAAGCAGCUGCAAAAUGGUUGCUACUCAAUAAAUAUUUGUUGAAUGAAUGAAGGAAUGAAAAGCCAAAUGUAAUACAUAGAAAAGUUGAUUAUAAAUUCUUUGGUACAAAAUAGACAGACAAAACAUAAUCUAGGAAAUAUGCACCCUGAGAAAUUGCUAUCAUCAUCUUAAUACCUUAUAACAACGAAAGUUCUUAAACUGGUCCCCUUAAUACCAUUGUGUUUAUUUUCUGUAUGUUUAUACUUUUAUGCUUUGGUUUCAUUUUCUACUUAUUAGUUAAAUGAUUAUGAGAACUGUGGGGAUAAAUUUAAAACAUUACUGUGUUUCUAUAGAGAGUUCUGCUGUAAUGCAGUGAUUAUGAAAUGAUCUCAAAUCUAUUCAGAAUUAUUAAAAGGUACAGUUCAAUAAAUAUUUUUAUUUUUGUUAAUUCUUCCCCAAAUCACAUUAAAACGAUCCUUUUGCACUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications