Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 35A (SNORD35A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 35A (SNORD35A) URS000026935A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD35A: SNORD35A has been shown to potentiate the oncogenic effects of the AML1-ETO fusion in leukemia through rRNA methylation [PMC6294694]. SNORD35A binding is increased on the 3′ splice site, snoU2-30 binding is enriched in the 5′ splice site, and SNORD38A shows an enrichment on the polypyrimidine tract [PMC9226514]. SNORD26 and SNORD96A are involved in determining the chondrocyte phenotype [PMC8638817]. Knockout of SNORD34, SNORD35A, and SNORD43 impaired clonogenic growth in a cell model, and depletion of SNORD14D reduced colony formation without affecting 18S-C762 methylation [PMC7114786]. Deletion of SNORD14D or SNORD35A suppresses clonogenic potential of leukemia cells in vitro and delays leukemogenesis in vivo [PMC7114786]. Knockdown of SNORD14D or SNORD35A also suppresses clonogenic potential of leukemia cells in vitro and delays leukemogenesis in vivo [PMC6629867]. Increased levels of three box C/D snoRNAs, including SNORD35A, were seen when CHO cells were exposed to fatty acids [PMC6466398]. RPL13A is a host gene encoding several snoRNAs including SNOD32a, SNOD33, and SNOD35a, and deregulation of these snoRNAs are associated with different types of cancer [PMC6466398]. Among other genes, downregulation of SNOD34, SNOD35A, SNOD38B, and SNOD71A was observed when expression of HOXA10 was silenced leading to impaired homologous recombination pathway and diminished temozolomide resistance [PMC5747948].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCAGAUGAUGUCCUUAUCUCACGAUGGUCUGCGGAUGUCCCUGUGGGAAUGGCGACAAUGCCAAUGGCUUAGCUGAUGCCAGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications