v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 484 (LINC00484) URS000025B3F2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00484: LINC00484 is a long non-coding RNA (lncRNA) that has been identified as one of the most clinically relevant lncRNAs, potentially serving as a biomarker [PMC5928764]. It has been found to be age-related, sex-related, and associated with TNM and tumor stage in various cancers [PMC5928764]. LINC00484 is also involved in the ceRNA network and serves as a center molecule for several miRNAs [PMC5731337]. In triple-negative breast cancer (TNBC), LINC00484, along with other lncRNAs such as DGCR5 and EMX2OS, may contribute to the pathogenesis of the disease [PMC5731337]. Furthermore, LINC00484 has been identified as one of the top differentially expressed genes in TNBC and may play a role in tumor suppression through down-regulation of specific signaling pathways [PMC5731337]. In other studies, LINC00484 has been associated with nephroblastoma development and found to be downregulated in this context [PMC7057018]. Additionally, LINC00484 has been validated and reported for its role in various cancers such as colorectal cancer [PMC5937496] and ferroptosis-related processes [PMC8691457]. It interacts with different genes through miRNA mediation such as ELAVL4, PHLPP2, BMP3, KLF4, TMEM100, TPM2 in specific ceRNA networks [PMC5937496].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUUAAAACCUAAAUGAGCAACAAACGAGGUGACGUGCGUUAUCAGUUUUGUCUUCCAUGUCUUCCUCAUCCUGCUGUUUGCUCCACGGCUCUUGACAGGAUGGAGACGAGGAAAGAACUUCCACAUCCACAUUCAAAACGUCUGCCAGAACUCCCUCAGGCGAUUACUUUAAAACAUGAAAGAAAUUGCACCUUUUCCUUAAGGGCAAGAUGGUGCUGUGGGCUUUCCUCUCUCCUGAUGAGAUGAUGCAAAUGGACUCCAUAGAGAAACGCUGCCCGUGUAACAAUGCAGUUACGCAACCCGGUGCAUGACACAUGAAUUGCAGCGCACCUGAGAUCCUGAUGAAAUCCUGGGAGCCUGGAGCUGUCAAACAUGGUUUUAAAAAAUAAAGGGAAUACACCCAGCCCACACCCUGACUUUACAACCUUUAAUUAAUUAGAGGAAAGAAAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications