Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Ile (AUU/C) (MT-TI) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Ile (AUU/C) (MT-TI) URS000025082B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TI: MT-TI is a tRNA gene that encodes isoleucine transfer RNA (tRNAIle) [PMC8685365]. It is one of the tRNA genes that are affected in at least one position, with 14 mutated positions reported [PMC3080857]. The most represented tRNA gene with reported mutations is mt-Tl1, followed by mt-Tk and MT-TI [PMC3080857]. Homoplasmic variants, including the MT-TI m.4300A>G variant, can exhibit variable penetrance and clinical variability [PMC9905091]. In a specific pedigree, a C to T transition in the MT-TI gene was identified through sequence analysis of the mitochondrial genome in the maternal lineage [PMC8685365]. The m.4295A>G (MT-TI) variant has been associated with maternal hypertension and maternal sensory hearing loss [PMC9395495]. Additionally, a large European collaboration has shown that mitochondrial DNA variants in MT-TI are causative for a Gitelman-like syndrome [PMC9415222]. References: - [PMC3080857]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3080857/ - [PMC9905091]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9905091/ - [PMC8685365]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8685365/ - [PMC9395495]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9395495/ - [ PMC9415222]: https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC9415222/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAAUAUGUCUGAUAAAAGAGUUACUUUGAUAGAGUAAAUAAUAGGAGCUUAAACCCCCUUAUUUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cloning vector pRS316-1B9 tRNA-Ile
2D structure Publications