Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (Domestic guinea pig) microRNA mir-23 URS000024C472_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCUGCUUGGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACGCAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Ailuropoda melanoleuca microRNA mir-23
  2. Bos taurus (cattle) microRNA mir-23
  3. Callithrix jacchus microRNA mir-23
  4. Camelus ferus microRNA mir-23
  5. Chlorocebus sabaeus microRNA mir-23
  6. Equus caballus (horse) microRNA mir-23
  7. Erinaceus europaeus microRNA mir-23
  8. Gorilla gorilla gorilla microRNA mir-23
  9. Heterocephalus glaber (naked mole-rat) microRNA mir-23
  10. Homo sapiens microRNA mir-23
  11. Loxodonta africana (African savanna elephant) microRNA mir-23
  12. Macaca mulatta microRNA mir-23
  13. Marmota monax (woodchuck) non-coding RNA
  14. Myotis brandtii microRNA mir-23
  15. Myotis davidii microRNA mir-23
  16. Myotis lucifugus (little brown bat) microRNA mir-23
  17. Nomascus leucogenys microRNA mir-23
  18. Oryctolagus cuniculus microRNA mir-23
  19. Ovis aries microRNA mir-23
  20. Pan troglodytes (chimpanzee) microRNA mir-23
  21. Papio anubis microRNA mir-23
  22. Pongo abelii microRNA mir-23
  23. Pteropus alecto (black flying fox) microRNA mir-23
  24. Ictidomys tridecemlineatus microRNA mir-23
  25. Tupaia chinensis microRNA mir-23
Publications