Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3165 URS0000237E04_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3165: Hsa-mir-3165 is a microRNA that has been detected in breast cancer tissue compared to normal breast tissue [PMC4289319]. In a study on sepsis-induced acute kidney injury (AKI), hsa-mir-3165 was found to be up-regulated in the AKI group compared to the non-AKI group [PMC5351858]. Additionally, hsa-mir-3165 was one of the eight differentially expressed miRNAs between the sepsis-induced AKI group and the non-AKI group [PMC5351858]. Further validation of these miRNAs revealed that hsa-mir-3165 was significantly up-regulated in the sepsis-induced AKI group compared to healthy controls [PMC5351858]. In another study, hsa-mir-3165 was identified as one of seven novel miRNAs targeting PCSK9, a gene associated with cholesterol metabolism [PMC8310920]. These findings suggest that hsa-mir-3165 may play a role in breast cancer, sepsis-induced AKI, and cholesterol metabolism. Further research is needed to fully understand its functions and potential therapeutic implications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGUGGAUGCAAUGUGACCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes (chimpanzee) ptr-miR-3165
Publications