Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mustela putorius furo tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2) secondary structure diagram

Mustela putorius furo tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2) URS0000225EE1_9669

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUCUGUGGCGCAAUGGAUAGCGCAUUGGACUUCUAAUUCAAAGGUUGUGGGUUCGAGUCCCACCAGAGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 71 other species

  1. Ailuropoda melanoleuca tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  2. Albula goreensis tRNA-Arg
  3. Alligator mississippiensis tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  4. Alosa alosa tRNA-Arg
  5. Anguilla anguilla (European eel) tRNA-Arg
  6. Bos taurus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  7. Callithrix jacchus tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  8. Callorhinchus milii tRNA-Arg (TCT) (tRNA-Arg-TCT-2 1 to 6)
  9. Canis lupus familiaris tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  10. Carlito syrichta tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  11. Cavia porcellus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  12. Ceratotherium simum simum tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  13. Chlorocebus sabaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  14. Choloepus hoffmanni tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  15. Chrysemys picta bellii tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  16. Cricetulus griseus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  17. Dallia pectoralis tRNA-OTHER
  18. Danio rerio tRNA-Arg (TCT) (tRNA-Arg-TCT-2 1 to 50)
  19. Dasypus novemcinctus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  20. Dipodomys ordii tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  21. Echinops telfairi tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  22. Eptesicus nilssonii tRNA-Arg
  23. Equus caballus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  24. Erinaceus europaeus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  25. Felis catus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  26. Gallus gallus tRNA-Arg (TCT) (tRNA-Arg-TCT-3-1)
  27. Gorilla gorilla gorilla tRNA-Arg (TCT) (tRNA-Arg-TCT-5-1)
  28. Heterocephalus glaber tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  29. Homo sapiens tRNA-Arg (anticodon TCT) 3-1 (TRR-TCT3-1, TRR-TCT3-2)
  30. Ictidomys tridecemlineatus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  31. Lamprotornis superbus tRNA-OTHER
  32. Latimeria chalumnae tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  33. Latimeria menadoensis (Menado coelacanth) tRNA-Arg
  34. Loxodonta africana tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  35. Macaca mulatta tRNA-Arg (TCT) (tRNA-Arg-TCT-5-1, tRNA-Arg-TCT-5-2)
  36. Melopsittacus undulatus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  37. Microcebus murinus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  38. Monodelphis domestica tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 3)
  39. Mus caroli tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  40. Mus musculus castaneus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  41. Mus musculus domesticus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  42. Mus musculus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  43. Mus musculus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-3-1)
  44. Mus pahari tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  45. Mus spretus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  46. Myotis lucifugus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  47. Nomascus leucogenys tRNA-Arg (TCT) (tRNA-Arg-TCT-5-1, tRNA-Arg-TCT-5-2)
  48. Notamacropus eugenii tRNA-Arg (TCT) (tRNA-Arg-TCT-1 1 to 3)
  49. Nothobranchius furzeri tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  50. Ochotona princeps tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  51. Oreochromis niloticus tRNA-Arg (TCT) (tRNA-Arg-TCT-3 1 to 4)
  52. Ornithorhynchus anatinus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  53. Oryctolagus cuniculus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  54. Oryzias latipes tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  55. Otolemur garnettii tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  56. Ovis aries tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  57. Pan troglodytes tRNA-Arg (TCT) (tRNA-Arg-TCT-5 1 to 3)
  58. Papio anubis tRNA-Arg (TCT) (tRNA-Arg-TCT-5-1, tRNA-Arg-TCT-5-2)
  59. Phrynosoma platyrhinos tRNA-OTHER
  60. Pongo abelii tRNA-Arg (TCT) (tRNA-Arg-TCT-5-1, tRNA-Arg-TCT-5-2)
  61. Procavia capensis tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  62. Rattus norvegicus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  63. Saimiri boliviensis boliviensis tRNA-Arg (TCT) (tRNA-Arg-TCT-4-1)
  64. Sarcophilus harrisii tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1, tRNA-Arg-TCT-1-2)
  65. Sorex araneus tRNA-Arg (TCT) (tRNA-Arg-TCT-1-1)
  66. Sus scrofa tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-2-2)
  67. Takifugu rubripes tRNA-Arg (TCT) (tRNA-Arg-TCT-5 1 to 3)
  68. Trichechus manatus latirostris tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  69. Tursiops truncatus tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  70. Vicugna pacos tRNA-Arg (TCT) (tRNA-Arg-TCT-2-1)
  71. Xenopus tropicalis tRNA-Arg (TCT) (tRNA-Arg-TCT-2 1 to 44)
2D structure Publications