Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Procavia capensis tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2) secondary structure diagram

Procavia capensis tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2) URS0000222FD2_9813

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 119 other species

  1. Ailuropoda melanoleuca tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  2. Albula glossodonta tRNA-OTHER
  3. Albula goreensis tRNA-Trp
  4. Alosa alosa (allis shad) tRNA-Trp
  5. Ameiurus melas (black bullhead) tRNA-Trp
  6. Anguilla anguilla (European eel) tRNA-Trp
  7. Astyanax mexicanus (Mexican tetra) tRNA
  8. Ataeniobius toweri tRNA-Trp
  9. Balaenoptera acutorostrata scammoni tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  10. Blattella germanica tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  11. Bos taurus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  12. Callithrix jacchus tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  13. Camelus ferus tRNA
  14. Canis lupus familiaris tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  15. Cavia porcellus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  16. Ceratotherium simum simum tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  17. Characodon lateralis tRNA-Trp
  18. Chlorocebus sabaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  19. Choloepus hoffmanni tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  20. Cimex lectularius tRNA-Trp
  21. Crassostrea angulata (Portuguese oyster) transfer RNA tryptophan (anticodon CCA)
  22. Crassostrea gigas tRNA
  23. Crassostrea virginica (Eastern oyster) tRNA-Trp
  24. Crenichthys baileyi tRNA-Trp
  25. Cricetulus griseus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  26. Cryptotermes secundus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  27. Dallia pectoralis tRNA-OTHER
  28. Danionella translucida tRNA-Trp
  29. Danio rerio tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 10)
  30. Dasypus novemcinctus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  31. Diaphorina citri (Asian citrus psyllid) tRNA
  32. Dicentrarchus labrax (European seabass) transfer RNA-Trp
  33. Dipodomys ordii tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  34. Echinops telfairi tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  35. Eptesicus nilssonii tRNA-Trp
  36. Equus caballus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  37. Erinaceus europaeus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  38. Eschrichtius robustus tRNA-Trp
  39. Felis catus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  40. Fukomys damarensis (Damara mole-rat) tRNA
  41. Gadus morhua tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 5)
  42. Gasterosteus aculeatus tRNA
  43. Gorilla gorilla gorilla tRNA-Trp (CCA) (tRNA-Trp-CCA-3 1 to 3)
  44. Haliotis rufescens tRNA-Trp
  45. Heterocephalus glaber tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  46. Hippoglossus stenolepis tRNA-Trp
  47. Homalodisca vitripennis tRNA-Trp
  48. Homo sapiens tRNA-Trp (anticodon CCA) 3-1 (TRW-CCA3 1 to 3)
  49. Ictidomys tridecemlineatus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  50. Larimichthys crocea tRNA
  51. Lepisosteus oculatus (spotted gar) tRNA
  52. Loxodonta africana tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 3)
  53. Macaca mulatta tRNA-Trp (CCA) (tRNA-Trp-CCA-3 1 to 3)
  54. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA tryptophan (anticodon CCA)
  55. Marmota monax (woodchuck) tRNA.Trp
  56. Megalops atlanticus (tarpon) tRNA-Trp
  57. Mercenaria mercenaria tRNA-Trp
  58. Merluccius polli tRNA-Trp
  59. Microcebus murinus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  60. Monodelphis domestica tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  61. Mus caroli tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  62. Mus musculus castaneus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  63. Mus musculus domesticus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  64. Mus musculus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  65. Mus musculus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2, tRNA-Trp-CCA-4-1, tRNA-Trp-CCA-4-2)
  66. Mus pahari tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  67. Mus spretus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1, tRNA-Trp-CCA-2-2)
  68. Mustela putorius furo tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  69. Myotis brandtii tRNA
  70. Myotis davidii tRNA
  71. Myotis lucifugus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  72. Neotoma lepida (desert woodrat) tRNA
  73. Nilaparvata lugens tRNA-Trp
  74. Nomascus leucogenys tRNA-Trp (CCA) (tRNA-Trp-CCA-6-1)
  75. Notamacropus eugenii tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  76. Nothobranchius furzeri tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  77. Ochotona princeps tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  78. Oreochromis niloticus tRNA-Trp (CCA) (tRNA-Trp-CCA-2 1 to 7)
  79. Ornithorhynchus anatinus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  80. Oryctolagus cuniculus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  81. Oryzias latipes tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  82. Otolemur garnettii tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  83. Ovis aries tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  84. Pangasianodon gigas tRNA-Trp
  85. Pangasianodon hypophthalmus tRNA-Trp
  86. Pangasius djambal tRNA-Trp
  87. Pan troglodytes tRNA-Trp (CCA) (tRNA-Trp-CCA-3 1 to 5)
  88. Papio anubis tRNA-Trp (CCA) (tRNA-Trp-CCA-3 1 to 4)
  89. Pediculus humanus corporis tRNA tRNA-Trp
  90. Pelobates cultripes (western spadefoot toad) tRNA.Trp
  91. Perca flavescens (yellow perch) tRNA-Trp
  92. Perca fluviatilis (European perch) tRNA-Trp
  93. Petromyzon marinus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1)
  94. Pleuronectes platessa tRNA-Trp
  95. Poecilia formosa tRNA
  96. Pongo abelii tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1, tRNA-Trp-CCA-3-2)
  97. Pteropus alecto tRNA
  98. Rattus norvegicus tRNA-Trp (CCA) (tRNA-Trp-CCA-2-1)
  99. Rhodnius prolixus (Kissing bug) tRNA tRNA-Trp
  100. Saimiri boliviensis boliviensis tRNA-Trp (CCA) (tRNA-Trp-CCA-3-1)
  101. Salmo salar (Atlantic salmon) tRNA
  102. Sarcophilus harrisii tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  103. Schistocerca cancellata (South American locust) transfer RNA tryptophan (anticodon CCA)
  104. Schistocerca gregaria (Grasshoppers) transfer RNA tryptophan (anticodon CCA)
  105. Schistocerca serialis cubense (Grasshoppers) transfer RNA tryptophan (anticodon CCA)
  106. Scleropages formosus tRNA
  107. Sorex araneus tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  108. Sus scrofa tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 4)
  109. Takifugu rubripes tRNA-Trp (CCA) (tRNA-Trp-CCA-3 1 to 7)
  110. Tetraodon nigroviridis tRNA
  111. Trialeurodes vaporariorum tRNA-Trp for anticodon CCA
  112. Trichechus manatus latirostris tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
  113. Tupaia chinensis tRNA
  114. Tursiops truncatus tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  115. Vicugna pacos tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 3)
  116. Xenopus laevis (African clawed frog) tRNA
  117. Xenopus tropicalis tRNA-Trp (CCA) (tRNA-Trp-CCA-1 1 to 27)
  118. Xiphophorus maculatus (southern platyfish) tRNA
  119. Zootermopsis nevadensis tRNA-Trp (CCA) (tRNA-Trp-CCA-1-1, tRNA-Trp-CCA-1-2)
2D structure