Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4784 URS000021E7E5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4784: Hsa-mir-4784 is a microRNA that has been investigated for its potential involvement in SARS-CoV-2 infection. In a study, the loss of hsa-mir-4784 binding to the Wuhan-Hu-1 Spike protein, but not to the Beta, Delta, and Omicron Spike proteins, was found to result in the loss of miRNA-mediated regulation of MAPK13. MAPK13 has been shown to indirectly promote inflammation-associated alveolar tissue damage and is integral for SARS-CoV-2 replication [PMC9721271]. The loss of hsa-mir-4784 binding sites on the S protein in Beta, Delta, and Omicron variants may contribute to their higher replication rates and pathogenesis compared to Wuhan-Hu-1 [PMC9721271]. Hsa-mir-4784 shares the same seed sequence as hsa-miR-3150b-3p and is considered a duplicate miRNA [PMC9721271]. The down-regulation of hsa-mir-4784 has been observed in miRNA microarray studies related to disease progression [PMC4626193] [PMC8005181]. Hsa-mir-4784 has also been found to be bound to hsa_circ_002048 and its down-regulation leads to up-regulation of hsa-miR-422a and hsa-miR3944_3p, inhibiting the expression of AP2M1 [PMC9716081]. In summary, hsa-mir-4784 is a microRNA that may play a role in SARS-CoV2 infection by regulating MAPK13 expression. Its down-regulation has been observed in disease progression studies and it is also involved in circRNA-mediated regulation networks.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGAGAUGCUGGGACUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications