Pteropus alecto (black flying fox) mir-154 microRNA precursor family

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) mir-154 microRNA precursor family URS000021C7D8_9402

79 nucleotides
1 database (Rfam)
Found in 12 other species
544 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGUACUUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUUAUUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAGUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Ailuropoda melanoleuca mir-154 microRNA precursor family
Chlorocebus sabaeus mir-154 microRNA precursor family
Gorilla gorilla gorilla (western lowland gorilla) mir-154 microRNA precursor family
Homo sapiens microRNA mir-154
Ictidomys tridecemlineatus microRNA 369 (ENSSTOG00000023972.2)
Macaca mulatta (Rhesus monkey) mir-154 microRNA precursor family
Marmota monax non-coding RNA
Nomascus leucogenys (Northern white-cheeked gibbon) mir-154 microRNA precursor family
Otolemur garnettii mir-154 microRNA precursor family
Pan troglodytes (chimpanzee) mir-154 microRNA precursor family
Papio anubis mir-154 microRNA precursor family
Pongo abelii mir-154 microRNA precursor family

2D structure

Publications