Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus microRNA mir-375 secondary structure diagram

Chlorocebus sabaeus microRNA mir-375 URS000020B181_60711

  • 68 nucleotides
  • 1 database (Rfam)
  • Found in 3 other species
  • pre_miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUGAGGCAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Ailuropoda melanoleuca mir-375
  2. Bos taurus (cattle) microRNA mir-375
  3. Callithrix jacchus microRNA mir-375
  4. Canis lupus familiaris (dog) microRNA mir-375
  5. Cavia porcellus (Domestic guinea pig) microRNA mir-375
  6. Equus caballus (horse) microRNA mir-375
  7. Felis catus microRNA mir-375
  8. Fukomys damarensis (Damara mole-rat) microRNA mir-375
  9. Gorilla gorilla gorilla microRNA mir-375
  10. Heterocephalus glaber microRNA mir-375
  11. Homo sapiens microRNA mir-375
  12. Loxodonta africana (African savanna elephant) microRNA mir-375
  13. Macaca mulatta (Rhesus monkey) microRNA mir-375
  14. Marmota monax non-coding RNA
  15. Mesocricetus auratus (golden hamster) microRNA mir-375
  16. Mus musculus (house mouse) microRNA mir-375
  17. Myotis brandtii microRNA mir-375
  18. Myotis lucifugus (little brown bat) microRNA mir-375
  19. Neotoma lepida microRNA mir-375
  20. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA mir-375
  21. Oryctolagus cuniculus microRNA mir-375
  22. Pan troglodytes (chimpanzee) microRNA mir-375
  23. Papio anubis (Olive baboon) microRNA mir-375
  24. Pongo abelii microRNA mir-375
  25. Pteropus alecto (black flying fox) microRNA mir-375
  26. Rattus norvegicus (Norway rat) microRNA mir-375
  27. Ictidomys tridecemlineatus microRNA mir-375
  28. Sus scrofa (pig) microRNA mir-375
2D structure