Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chlorocebus sabaeus tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1) secondary structure diagram

Chlorocebus sabaeus tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1) URS0000209048_60711

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUAGCAUGCAUGAGGUCCCGGGUUCGAUCCCCAGCAUCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Ailuropoda melanoleuca tRNA-Ala (AGC) (tRNA-Ala-AGC-7-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  3. Bos taurus tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  4. Callithrix jacchus tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  5. Camelus ferus tRNA
  6. Carlito syrichta tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  7. Ceratotherium simum simum tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  8. Choloepus hoffmanni tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  9. Dipodomys ordii tRNA-Ala (AGC) (tRNA-Ala-AGC-7-1)
  10. Equus caballus tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  11. Felis catus tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  12. Gorilla gorilla gorilla tRNA-Ala (AGC) (tRNA-Ala-AGC-7-1)
  13. Homo sapiens tRNA-Ala (anticodon AGC) 4-1 (TRA-AGC4-1)
  14. Ictidomys tridecemlineatus tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  15. Loxodonta africana tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  16. Macaca mulatta tRNA-Ala (AGC) (tRNA-Ala-AGC-8-1)
  17. Marmota monax tRNA.Ala
  18. Microcebus murinus tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  19. Mustela putorius furo tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  20. Nomascus leucogenys tRNA-Ala (AGC) (tRNA-Ala-AGC-7-1)
  21. Otolemur garnettii tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  22. Ovis aries tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  23. Pan troglodytes tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  24. Papio anubis tRNA-Ala (AGC) (tRNA-Ala-AGC-8-1)
  25. Pongo abelii tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  26. Procavia capensis tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  27. Saimiri boliviensis boliviensis tRNA-Ala (AGC) (tRNA-Ala-AGC-6-1)
  28. Sorex araneus tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  29. Sus scrofa tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1, tRNA-Ala-AGC-5-2)
  30. Trichechus manatus latirostris tRNA-Ala (AGC) (tRNA-Ala-AGC-5-1)
  31. Tupaia chinensis tRNA
  32. Tursiops truncatus tRNA-Ala (AGC) (tRNA-Ala-AGC-4-1)
  33. Vicugna pacos tRNA-Ala (AGC) (tRNA-Ala-AGC-9-1)
2D structure Publications