v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) microRNA oar-mir-99a precursor URS0000208A34_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-99a: Oar-mir-99a is a differentially expressed miRNA that has been reported in previous studies and is associated with differing curliness in the hair follicles of Hu sheep and Chinese tan sheep [PMC8872417]. In a specific study, a total of 3 differentially expressed miRNAs, including oar-mir-99a, were identified in the Vac Tf vs. Vac T0 comparison [PMC6206264]. Additionally, oar-mir-99a was predicted to target the CAEV virus at specific nucleotide sequences [PMC6339376]. The downregulated expression of miRNAs such as oar-let-7b, oar-mir-99a, and oar-miR-125b was observed in infected sheep [PMC6339376]. These findings suggest that oar-mir-99a plays a role in hair follicle curliness and may have implications in viral targeting. The references for each sentence are as follows: [PMC8872417], [PMC6206264], and [PMC6339376].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Aotus nancymaae miRNA (ENSANAG00000003299.1)
  2. Bos taurus (cattle) microRNA bta-mir-99a precursor
  3. Capra hircus microRNA chi-mir-99a precursor
  4. Cebus imitator (Panamanian white-faced capuchin) microRNA 99a (ENSCCAG00000005482.1)
  5. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000012016.1)
  6. Chlorocebus sabaeus (African green monkey) microRNA 99a (ENSCSAG00000027484.1)
  7. Gorilla gorilla gorilla ggo-mir-99a (ENSGGOG00000032928.2)
  8. Gorilla gorilla (western gorilla) microRNA ggo-mir-99a precursor
  9. Homo sapiens microRNA hsa-mir-99a precursor
  10. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-99a precursor
  11. Macaca mulatta (Rhesus monkey) microRNA mml-mir-99a precursor
  12. Macaca nemestrina microRNA mne-mir-99a precursor
  13. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000023489.1)
  14. Myotis lucifugus (little brown bat) miRNA (ENSMLUG00000017820.1)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 99a (ENSNLEG00000026317.2)
  16. Otolemur garnettii miRNA (ENSOGAG00000017500.1)
  17. Pan paniscus microRNA ppa-mir-99a precursor
  18. Pan troglodytes (chimpanzee) microRNA ptr-mir-99a precursor
  19. Pteropus vampyrus (large flying fox) miRNA (ENSPVAG00000027869.1)
  20. Rhinopithecus bieti miRNA (ENSRBIG00000018700.1)
  21. Rhinopithecus roxellana (Golden snub-nosed monkey) miRNA (ENSRROG00000018052.1)
  22. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016104.1)
  23. Vicugna pacos miRNA (ENSVPAG00000015619.1)
 Publications