Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 18 (SNORA18) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 18 (SNORA18) URS0000202A89_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA18: SNORA18, a small nucleolar RNA (snoRNA), has been studied in relation to its role in Hep3B cells [PMC9629112]. Reduction of SNORA18 in Hep3B cells treated with DDX24-specific shRNA and SFN has been found to have various effects on cellular expression, including increased phosphorylation of AKT and ERK, as well as increased expression of ZO-1, N-cadherin, and β-catenin. Additionally, it decreases the expression of cleaved-PARP and cleaved caspase-7 [PMC9629112]. A study has also reported 9 differentially expressed snoRNAs, including SNORA18 (ACA18), SNORA20 (ACA20), SNORA40 (ACA40), SNORA57 (ACA57), SNORD78 (ENSG00000212378), U17b, U44, U78, and U79 [PMC8538251]. These findings provide valuable insights into the role of SNORA18 in cellular processes and highlight its potential significance in various biological pathways [PMC9629112] [PMC8538251]. Further research is needed to fully understand the mechanisms by which SNORA18 influences these cellular processes and its potential implications for human health [PMC9629112].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGAGGUCUAUCCCGAUGGGGCUUUUCCUGUAGCCUGCACAUCGUUGGAAACGCCUCAUAGAGUAACUCUGUGGUUUUACUUUACUCACAGGACUAUUGUUAGAUCUGUGGGAAGGAAUUACAAGACAGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications