Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 5A (SNORA5A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 5A (SNORA5A) URS00001FC3CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA5A: SNORA5A is a small nucleolar RNA (snoRNA) that is part of the SLERT complex, along with SNORA5C, and is required for translocation of SLERT into the nucleolus [PMC7766524]. The expression levels of SNORA5A were found to be increased in a study that examined the transcriptional levels of CDC37L1-AS1 and SNORA5A over time [PMC7766524]. In another study, SNORA5A was identified as one of the snoRNAs that were more strongly expressed in patients with more severe disease [PMC9219770]. Additionally, a predictive expression profile of snoRNAs associated with lung adenocarcinoma included SNORA5A as one of the identified snoRNAs [PMC9197630]. The nuclear position signals for SNORA5A were detected in a study that searched for lncRNA candidates using the lncATLAS database [PMC6292939]. Furthermore, SNORA5A was used in genetic constructs to generate different constructs for experimental purposes [PMC4234469]. Overall, these studies highlight the involvement and potential significance of SNORA5A in various biological processes and disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGCCGUGUCAAAUUCAGUACCUGUCCUAUGCAUGGUAGGCACUGGCCCAGAAGGCUGCCACAGAAACACUGUGACUCAUGGGCCCUGUUCCUGUGUCCCAGGCUCAGGGAUAAAUUUGGUUACAGACAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications