v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-449a URS00001F5B39_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-449a: Bta-mir-449a is a differentially expressed (DE) microRNA (miRNA) that is suppressed in cows under metabolic stress [PMC6731312]. It is also identified as a common and upregulated DE in low-RFI (residual feed intake) steers of different breeds [PMC7653039]. Bta-mir-449a is predicted to target multiple DE genes in different breeds, with only three target genes common to all three breeds [PMC7653039]. To validate the expression levels of DE miRNAs and their target genes, bta-mir-449a and other miRNAs were selected for qPCR validation [PMC9581192]. Bta-mir-449a, along with other DE miRNAs, was found to be upregulated in the liver tissue of low-RFI steers [PMC7653039]. Among the DE miRNAs, bta-mir-449a showed the highest fold-change increase [PMC7312616].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGCAGUGUAUUGUUAGCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-449a
  2. Canis lupus familiaris cfa-miR-449a
  3. Cavia porcellus (domestic guinea pig) cpo-miR-449a-5p
  4. Cervus elaphus cel-miR-449a
  5. Cricetulus griseus cgr-miR-449a
  6. Dasypus novemcinctus dno-miR-449a-5p
  7. Echinops telfairi Ete-Mir-34-P3c_5p (mature (guide))
  8. Equus caballus eca-miR-449a
  9. Homo sapiens hsa-miR-449a
  10. Macaca mulatta mml-miR-449a-5p
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-449a-5p
  12. Mus musculus mmu-miR-449a-5p
  13. Oryctolagus cuniculus ocu-miR-449a-5p
  14. Pongo pygmaeus ppy-miR-449a
  15. Pteropus alecto pal-miR-449a-5p
  16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
  17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3c_5p (mature (guide))
 Publications