Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-510-5p URS00001CC4BD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-510: Hsa-mir-510 is a miRNA that has been studied in various contexts. In the GSE36791 dataset, the expression levels of hsa-mir-510 showed no statistical difference between samples of subarachnoid hemorrhage (SAH) and normal samples [PMC8768506]. However, hsa-mir-510, along with other RNAs such as JMJD1C-AS1 and LINC01144, was identified as a potential biomarker for predicting SAH [PMC8768506]. In another study, two SNPs (rs5951785 and rs1447393) near hsa-mir-510 were found to be associated with non-obstructive azoospermia (NOA) [PMC5226495]. The expression levels of hsa-mir-510 were significantly down-regulated in mutant types of these SNPs [PMC5226495]. Additionally, overexpression of hsa-mir-510 was associated with improved overall survival in patients with melanoma [PMC8046546]. Hsa-mir-510 has also been implicated in the regulation of serotonin receptor genes in irritable bowel syndrome (IBS) [PMC5561373]. Furthermore, hsa-mir-510 has been found to be present in circulation and can be derived from various tissues of origin [PMC3117799]. Overall, these studies highlight the potential role of hsa-mir-510 as a biomarker and its involvement in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUCAGGAGAGUGGCAAUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications