v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Eptesicus nilssonii tRNA-Ser secondary structure diagram

Eptesicus nilssonii tRNA-Ser URS00001C3F54_59451

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUGUGAUGGCCGAGUGGUUAAGGCGUUGGACUCGAAAUCCAAUGGGGUCUCCCCGCGCAGGUUCGAAUCCUGCUCACAGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 55 other species

  1. Ailuropoda melanoleuca tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  2. Balaenoptera acutorostrata scammoni tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  3. Bos taurus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  4. Callithrix jacchus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  5. Camelus ferus tRNA
  6. Canis lupus familiaris tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  7. Carlito syrichta tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  8. Cavia porcellus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  9. Ceratotherium simum simum tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  10. Chlorocebus sabaeus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  11. Choloepus hoffmanni tRNA-Ser (CGA) (tRNA-Ser-CGA-2-1)
  12. Cricetulus griseus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  13. Dasypus novemcinctus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  14. Dipodomys ordii tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  15. Echinops telfairi tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  16. Equus caballus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  17. Erinaceus europaeus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  18. Felis catus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  19. Fukomys damarensis tRNA
  20. Gorilla gorilla gorilla tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  21. Heterocephalus glaber tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  22. Homo sapiens tRNA-Ser (anticodon CGA) 1-1 (TRS-CGA1-1)
  23. Ictidomys tridecemlineatus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  24. Loxodonta africana tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  25. Macaca mulatta tRNA
  26. Marmota monax (woodchuck) tRNA.Ser
  27. Microcebus murinus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  28. Mus caroli tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  29. Mus musculus castaneus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  30. Mus musculus domesticus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  31. Mus musculus musculus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  32. Mus musculus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  33. Mus pahari tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  34. Mus spretus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  35. Mustela putorius furo tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  36. Myotis brandtii tRNA
  37. Myotis davidii tRNA
  38. Myotis lucifugus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  39. Neotoma lepida tRNA
  40. Nomascus leucogenys tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  41. Ochotona princeps tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1, tRNA-Ser-CGA-1-2)
  42. Oryctolagus cuniculus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1, tRNA-Ser-CGA-1-2)
  43. Otolemur garnettii tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  44. Ovis aries tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  45. Pan troglodytes tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  46. Papio anubis tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  47. Pongo abelii tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  48. Procavia capensis tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  49. Saimiri boliviensis boliviensis tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  50. Sorex araneus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  51. Sus scrofa tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  52. Trichechus manatus latirostris tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  53. Tupaia chinensis tRNA
  54. Tursiops truncatus tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
  55. Vicugna pacos tRNA-Ser (CGA) (tRNA-Ser-CGA-1-1)
 2D structure