Homo sapiens (human) ATP1B3 antisense RNA 1 (ATP1B3-AS1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ATP1B3 antisense RNA 1 (ATP1B3-AS1) URS00001BD8BB_9606

376 nucleotides
8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, LncBook, LNCipedia, NONCODE)
Found in 0 other species
13 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ATP1B3-AS1: ATP1B3-AS1 is a downregulated lncRNA in bladder cancer tissues compared to bladder tissues [PMC8328735][PMC7961759]. It is also upregulated in HEU infants, indicating exposure to viral particles [PMC6889308]. ATP1B3-AS1 is an antisense transcript of the ATP1B3 gene, which belongs to the Na+/K+ ATPase family [PMC6889308]. In bladder cancer, the expression levels of ATP1B3-AS1 are lower in the high-risk group [PMC8328735]. However, in breast tumors, ATP1B3-AS1 is identified as a putative driver lncRNA [PMC6316884]. It has also been found to interact with other genes mediated by hsa-mir-96, hsa-mir-93, and hsa-mir-182 [PMC7324900]. In addition to bladder cancer and breast tumors, ATP1B3-AS1 has been found to be highly expressed in the high-risk group of another study [PMC8818872]. However, there are limited studies on this lncRNA as it is relatively new and not widely reported in the literature [PMC9977555].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGACUAGCCUAGGGAAUAAAUGCCAAAUUUUACAAACAUUUCUUCCACUUUUGUGCUUUUCUAAAAACAAACAAAAAAUCCACAACUAAAUAAACAAAAUUAAAACUCCACCUGCUUUGAUUAUUUUAUGUACUUCACACACCUCUCUCCAAAGCAAAAGGGAAAGCUAACUGAAAUCCGAAUCAUUAAAUCUGGGUUUUUCAUUAACAUUUCCCCCAACUAUUCUAGAAGCAAAGGAUACGUAAUAGAUAAACAAGAAGAAAAAUGCAUUUAAAACCUUAAGGGGACCCAGCACUCCAUCCAAGCUUAUCUAUGCAGCCUGCUCACAGGCUCCUGUAUACAGGCGCACUGUCAUGAAAUUAGCACUUCUACCCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications