v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNF32 antisense RNA 2 (ZNF32-AS2) URS00001BA165_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZNF32-AS2: ZNF32-AS2 is a long non-coding RNA (lncRNA) that is included in a ceRNA network with other lncRNAs, miRNAs, and mRNAs, and is involved in lncRNA-miRNA-mRNA pathways [PMC8672116]. Overexpression of ZNF32-AS2 has been found to have significant value in evaluating the overall survival (OS) and progression-free interval (PFI) of pancreatic cancer (PC) patients [PMC9632290]. ZNF32-AS2 expression is correlated with other lncRNAs, including SLC25A25-AS1, AC020558.2, AP4B1-AS1, AL355488.1, AC109460.3, SNHG1, C3orf35, LMNTD2-AS1, and AL365330.1 [PMC9632290]. The overexpression of ZNF32-AS2 and these related lncRNAs is associated with a shorter OS and PFI in PC patients [PMC9632290]. Additionally, ZNF32-AS2 has been identified as one of the prognostic DEnrlncRNAs in PC patients based on Cox regression analysis [PMC9194958]. The roles of ZNF32-AS2 have not been clarified previously; however, it has been found to be co-expressed with certain cancer-related genes (CRGs) including LIPT1 MTF1 GLS ATP7A [PMC9846072]. In summary,ZNF32-AS2 is an lncRNA that plays a role in the ceRNA network and has prognostic value for PC patients. It is co-expressed with other lncRNAs and CRGs associated with cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAACAGCAAGCUCUACCAAAGCAAGGUCUCCUCUGCUUCCUCAGACUGCCGACCAGUGCUGAGAACAGGGACACUGAAUAUCUGUGAGCUGAGCGCAUCCAGCCAUCAACUGACUCACUCACUGAAGAACGCUACAUUCUGGGCAUAUCUUCCAUGACAGUCCAGCAGGGUAGCUGUUGGAAAUCCAAACAUGUCCACUCCUGCUUACGACCUCAGUCACCACCUCUUCAUAUGAUUCUUCCAUGGGCUGUUCCUGAGCACCUGAGGGAGAAAAACAAACAGAAACAAACAGGAAAGGGCAGAAUAAUUGAUAUGUGAGAAGGAAAAAGUCAACAGUUGUUGAGACAUAAGUGAAUGCUGGAGUACAGUGACUCAAUUACAGCUUGCUGUGACUUUGAACUCCUGGACUCAACGGAUCCUCCCACUUCAGCCUCCCAAAUAACUAGGACUACAGCACCUGGUUCUUCUUGACAACUGCACAUUCUGCUACAUGCUGUGAUGACCAGGAGAAUCAUUUAAAUUUUUAUUUGGAGGACUCACUUCCAACUUGGAACACAAGCUGCAAAGGAAUUCCCUACCAGCAUGCCAGCACAUCAUUUGGAAGUUCAAGGUAUUCUUGCUCAACAGCUGCACACACAUUAAAAGUCCCUGGGGUACAUGGCGCCUGCUGCCUGGGGUUGGACUCUGUCGCCGGGGAUUCCAGAAAUUAGAGUAGAAUUCACAGCUCUGCCUCUCCACCUGCUGUGAGGUCUUCAAGUUACAACUCCGCCGCCUAUCAGGGACCUCCGUGAUUAGUAAGGGAGAAAUUGUCAUAUUUUUCUCCCUAGAUCACAGGUCUGAGGAAGCAGUUUCCCCAAGAUUUUGUAAAAGUGGCUUUAUAAUUAAAAACAUUGAUUUUCCUAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications