Homo sapiens (human) DPYD intronic transcript 1

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DPYD intronic transcript 1 URS00001B87E6_9606

401 nucleotides
9 databases (ENA, Ensembl, ENSEMBL_GENCODE, Expression Atlas, GeneCards, LncBook, LNCipedia, MalaCards, NONCODE)
Found in 0 other species
3 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dpyd-it1: DPYD-IT1 is a novel sense intronic long non-coding RNA (lncRNA) gene located within intron 14 of the DPYD gene, spanning over 26 kb on the reverse strand of chromosome 1 [PMC4936614]. This lncRNA is comprised of two exons, one long intron, and is processed into a 401 bp transcript [PMC4936614]. DPYD-IT1's location is significant as intron 14 is a major locus for dihydropyrimidine dehydrogenase deficiency and the gene itself contains primate-specific DNA elements such as L1MC1 and Alu elements [PMC4936614]. The complexity of DPYD's molecular structure includes the overlap of DPYD-IT1's 5′-end with the telomeric border of the computationally predicted FRA1E fragile site, suggesting a potential region susceptible to breakage within this lncRNA gene [PMC4936614]. Despite its intriguing structure and location, no association with this lncRNA was found in UK Biobank samples for specific single nucleotide polymorphisms (SNPs) [PMC6252362]. DPYD-IT1 was identified as one of the top seven significantly upregulated lncRNAs in a study that depicted its expression in a heatmap [PMC9761174].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCCACUGAAAUCUCAGCUCAUGUCUGGUGGCCCUUUUUGCCAGGCUCUGGUCUUAAGAUGGUCCUGGGUCCUUACUGCCACUCCCAGUGUCCUCUACUGUCCCUUGUGGUUUUCCUGCACAAGGCUAUAUCUUUUCUCUUCAGGCCUCCCUGUUCCCUGAGAUGCGACAAUAUUGAAAUUAGGCUAUUUAAAGUACUUCAUGACUAAAACACGAAAAGCAAUGGCAACAAAAACCAAAAUUGACAAACGGGAUCUAAUUAAACUAAAGAGCUUCUGCACAGCAAAAGAAACUACCGUCAGAGUGAACAGGCAACCUACAGAAUGGGAGAAAAUUUUUACAAUCUGCUCAUCUGACAAAGGGCUAAUAUCCAGAAUCUACAAAGAACUUAAACAAAUUUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Expression

Publications