Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-320 URS00001B4903_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-320: ssc-mir-320 is a microRNA that has been previously shown to be involved in the regulation of IFN-β expression [PMC10059919]. In a recent study, researchers aimed to investigate whether ssc-mir-320 is also involved in the regulation of TLR3 by lncRNA 8244 [PMC10059919]. The study utilized a pmirGLO-mut-CCR7 plasmid and transfected it into cells. The relative dual luciferase activity of the ssc-mir-320 mimics group was compared to the NC group, and no significant difference was observed [PMC10059919]. This suggests that ssc-mir-320 may not play a direct role in regulating TLR3 through lncRNA 8244. Reference: [PMC10059919]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAGCUGGGUUGAGAGGGCGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications