Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
hsa-mir-212: Hsa-mir-212 is a mature microRNA with the sequence UAACAGUCUCCAGUCACGGCC [ABI/Life Technologies; 4427975] [1]. It has been shown to have a negative regulatory function on the expression of INTU and IFT88 [PMC9596204] [2]. Additionally, hsa-mir-212 has been found to downregulate the expression of RBP2 in hepatocellular carcinoma cells [PMC4665154] [3]. These findings suggest that hsa-mir-212 plays a role in regulating gene expression and may have implications in cancer research [3].
References:
[1] ABI/Life Technologies; 4427975
[2] PMC9596204
[3] PMC4665154
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset