Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-513c-3p URS00001A4ABF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-513c: Hsa-mir-513c is a differentially expressed microRNA (DEmiRNA) that has been identified in various studies. In one study, the volcano plot and heat map analysis revealed hsa-mir-513c as one of the top 10 upregulated DEmiRNAs in MSC-released Exos [PMC9507792]. Another study found hsa-mir-513c to be significantly downregulated in metastatic samples [PMC7140886]. The downregulation of hsa-mir-513c has been shown to promote the proliferation and invasiveness of neuroblastoma and glioma cells [PMC7140886]. Interestingly, despite using the same source data, a panel of deregulated miRNAs showed no similarities with the set identified by another study, except for hsa-mir-513c [PMC7140886]. Hsa-mir-513c is part of a cluster on the human X chromosome that includes 15 miRNAs [PMC3563971]. It has also been found to be upregulated in HIV-1 infected cells [PMC4885076]. Additionally, hsa-mir-513c was among the top five most upregulated miRNAs in CAF-derived exosomes [PMC7581790]. In another analysis, hsa-mir-513c was among the significantly deregulated miRNAs detected in RB tumor samples and serum samples [PMC3547501]. References: [PMC9507792] [PMC7140886] [PMC7140886] [PMC3563971] [PMC4885076] [PMC7581790] [PM3547501]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAUUUCACCUUUCUGAGAAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications