Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) pha-miR-30c URS000019907A_9557

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCUCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Alligator mississippiensis ami-miR-30c-5p
  2. Anolis carolinensis (green anole) aca-miR-30c-5p
  3. Bos taurus bta-miR-30c
  4. Callorhinchus milii eshark_mir-30_4
  5. Capra hircus (goat) chi-miR-30c-5p
  6. Cricetulus griseus cgr-miR-30c-2
  7. Equus caballus eca-miR-30c
  8. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-8947
  9. Gorilla gorilla gorilla ggo-miR-30c (MIR30C)
  10. Gorilla gorilla (western gorilla) ggo-miR-30c
  11. Haplochromis burtoni abu-miR-30b
  12. Homo sapiens hsa-miR-30c-5p
  13. Lagothrix lagotricha (brown woolly monkey) lla-miR-30c
  14. Macaca mulatta (Rhesus monkey) mml-miR-30c-5p
  15. Macaca nemestrina mne-miR-30c
  16. Microcebus murinus (gray mouse lemur) mmr-miR-30c
  17. Monodelphis domestica mdo-miR-30c-5p
  18. Mus musculus mmu-miR-30c-5p
  19. Ornithorhynchus anatinus (platypus) oan-miR-30c-5p
  20. Oryzias latipes (Japanese medaka) ola-miR-30c
  21. Otolemur garnettii (small-eared galago) oga-miR-30c
  22. Ovis aries (sheep) miscellaneous RNA
  23. Pan troglodytes ptr-miR-30c
  24. Pongo pygmaeus (Bornean orangutan) ppy-miR-30c
  25. Rattus norvegicus rno-miR-30c-5p
  26. Salmo salar ssa-miR-30a-5p
  27. Sus scrofa ssc-miR-30c-5p
  28. Tupaia chinensis (Chinese tree shrew) tch-miR-30c-5p
  29. Tursiops truncatus (common bottlenose dolphin) miR-30c-5p
  30. Xenopus tropicalis xtr-miR-30c