Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 31 (SNORA31) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 31 (SNORA31) URS000019135F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA31: SNORA31 is a small nucleolar RNA (snoRNA) that has been implicated in various biological processes [PMC7376819]. In a study, it was found that the HSE (herpes simplex encephalitis) cohort had a higher prevalence of rare SNORA31 variants, suggesting a potential link between SNORA31 mutations and HSE [PMC7376819]. The conservation of SNORA31 and the residues mutated in patients further support this association [PMC7376819]. Functional analysis revealed that wild-type snoRNA31 is functional in cortical neurons [PMC7376819]. Additionally, two of the four mutant alleles were found to be loss-of-expression, and other loss-of-expression variants in the general population had low frequency [PMC7376819]. The susceptibility of fibroblasts and iPSC-derived neurons from patients to HSV-1 (herpes simplex virus 1) infection further strengthens the connection between SNORA31 mutations and viral susceptibility [PMC7376819]. Moreover, fibroblasts from patients were also susceptible to other neurotropic viruses such as VZV (varicella-zoster virus), MeV (measles virus), VSV (vesicular stomatitis virus), and EMCV (encephalomyocarditis virus) [PMC7376819]. Furthermore, snoRNA31 was identified as a cell-intrinsic antiviral factor in cortical neurons, acting independently of TLR3 and IFNAR1/IFNAR2 response pathways [PMC7376819]. Transcriptome analysis revealed impaired responses to HSV-1 infection in SNORA31-mutated hPSC-derived cortical neurons [PMC7376819]. Additionally, isogenic hESC-derived cortical neurons with heterozygous SNORA31 null mutations exhibited high susceptibility to HSV-1 infection [PMC7376819]. In another study focused on metritis, it was found that a variant near SNORA31 on BTA4 was associated with metritis as well as other reproductive traits such as production and dystocia. This suggests potential involvement of SNORA31 in reproductive health [PMC6958677]. Overall, these findings highlight the potential role of SNORA31 in viral susceptibility and reproductive health, providing valuable insights for further research and understanding of these conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGCAUCCACUGAUAGACCUUGAACAAUUUACUGUUGUUCUUUUGGUUUGCACUAGGAUGCAAAAGAAAGAAAUCCCUGCGCUUUCUGUCUGUCUUUGUGGCGGCCCAGAUUGAAUUGGGGAAUACAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications