Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-let-7e URS0000190DC2_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-let-7e: Bta-let-7e is a microRNA that is part of the miR-let-7 family [PMC7230347]. It has been identified as a target site in the novel_circ_0006981 [PMC7230347]. Additionally, bta-let-7e is one of the hub miRNAs in the red module, along with bta-let-7a-5p and bta-let-7f, and has been associated with the insulin-like growth factor receptor signaling pathway [PMC6637853]. It is also involved in various biological processes, along with other hub miRNAs such as bta-miR-33a/b, bta-miR-100, and bta-miR-204 [PMC6637853]. Bta-miR-33a/b, bta-miR100, and other hub miRNAs are part of different families such as miR-Let 7 (including bta-Let 7a 5p), miR30 (including bta-miR30a 5p), miR148 (including bta-miRNA148a), and miRNA26 (including BTA-MIR26A) [PMC7191744]. Furthermore, three single nucleotide polymorphisms (SNPs) were found in the seed regions of three different microRNAs including BTA-Let 7e. These SNPs were located in QTL regions associated with protein content, protein yield, and fat yield [PMC8486775]. Overall, these findings highlight the importance of BTA-Let 7e in various biological processes and its potential role in regulating protein content and fat yield.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGUAGGAGGUUGUAUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Capra hircus let-7e
  2. Gorilla gorilla gorilla ggo-let-7e (MIRLET7E)
  3. Gorilla gorilla (western gorilla) ggo-let-7e
  4. Homo sapiens (human) miscellaneous RNA
  5. Mus musculus Mus_musculus piRNA piR-mmu-8257831
  6. Ovis aries (sheep) miscellaneous RNA
Publications