Homo sapiens (human) prostate cancer associated transcript 2 (PCAT2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) prostate cancer associated transcript 2 (PCAT2) URS000018F875_9606

575 nucleotides
10 databases (Ensembl, Ensembl/GENCODE, Expression Atlas, GeneCards, HGNC, LncBook, LNCipedia, MalaCards, NONCODE, RefSeq)
Found in 0 other species
475 publications
1. lncRNA
2. antisense lncRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PCAT2: PCAT2 is a long noncoding RNA (lncRNA) associated with prostate cancer [PMC8606679]. The observations made on the native 8q24 can be replicated by introducing a PCAT2 transgene into a chromosome locus that initially lacked ectopic CENP-A/C [PMC8890707].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

ACUAUUUUGUGUAAUACCAUCAUAUCGGCUGCUGUUAACUAUCAGUACCUGAAUUUUGGAGGGAACACAUUCAAACUAUAGCAUUUAUUUAGGCUAAAAAGAUAGUUCAUUGUCAGUGUAUGAAAAACCUACUGAUUUUUUACGUUGAUUUUAUAUACUGCAACUUUAUUGAAUUCUCAACAAAUGGUGUUGAAAAAACUGGAUGUCCUCAUGAAGAAGAAUGAAAUUGAACACAUCACAUCCCAUAUACAAGAAUCAACUCAAAAUAUUUCCAAAUUCAAACAUUAUGAAGUUUGAGCUAUUUAGGAAGUUAAGGAGAUAAUCAGAUCAUUUCGUCAGACACCCUUAAGGCACUGAUGCUCUCAGUUGAUCUAGCAAAUAGGCAUCUGUCACAGAAAAUAGAGAAGAUAUCCCAAGAGAAGAGGAGAAACUCCACAAUGUGAAGAGAUUUCCAGAGGCAUCAGCACUCCGUCUGUCACUAUUGGCAUCCUGUGACAUGGUUUAGUUUAUGCGUGCUGGUUAGGCUGAUUUACAUAAUACAUUAUCUAGUUAUACCUUAAAUAAACCUCAAAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New

Publications