v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ABCA9 antisense RNA 1 (ABCA9-AS1) URS000018F63F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ABCA9-AS1: ABCA9-AS1 is a long non-coding RNA (lncRNA) that has been identified as differentially expressed in various studies [PMC8502877]. It has been found to be associated with stemness and survival in lung adenocarcinoma (LUAD) patients [PMC7431877]. Additionally, ABCA9-AS1 has been shown to have prognostic value in LUAD patients [PMC8798056]. It is up-regulated in calcium oxalate monohydrate-induced epithelial-mesenchymal transition (EMT) of renal tubular epithelial cells [PMC9990240]. ABCA9-AS1 is also part of a prognostic signature based on cuproptosis-related lncRNAs [PMC9990240]. Furthermore, it has been found to be negatively correlated with overall survival in various cancers [PMC6043529]. In high-risk groups, the expression of ABCA9-AS1 is higher compared to low-risk groups [PMC6196588]. In terms of function, ABCA9-AS1 may be involved in the skeletal system, protein binding, DNA binding, cell cycle, and the p53 signaling pathway [PMC6196588]. Lastly, ABCA9-AS1 is targeted by hsa-mir-195 in a competing endogenous RNA (ceRNA) network of downregulated lncRNAs and mRNAs [PMC6196588]. References: [PMC8502877] [PMC7431877] [PMC8798056] [PMC9990240] [PMC6043529] [PM6196588]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUGCCGCCUUGCAGUUUGAUCUCAGACUGCUGUGCUAGCAAUCAGCGAGACUCCGUGGGCGUAGGACCCUCUGAGCCAGUCACCAAUGCUGCUCAUUGCAAUGUAUGGAGUGAAAGAGGCUGCCAUCGGUAUCCAGAAGAAGGUGUUACUUCGGUACCCAUACUCAUAAUCCAUAUGCUCCUGAAAUCAUGUGGAACAUGCAACUAGGACCUUCUGAACACGUAGCCUGAUUUACUUAUGAAGAAGCAAAUUCAACCAAGUGAUACGAAUUGUCUAAGGUCAUACAGUUAAUAACUUGUAAGAGCCCAGCACAGCACAGAUUUACAAAAUGAUACACAAAGACCUCAGAGGUGAGUCAAUGAUUUACCUCCCUACCUCCUCUUUAGUUGCUUUGUGCAACAAACAUUAAGGUUAAGUAAACUUGCAGAAUCUAUUUCUAAAACAAACUCUCCCAUGUCGUAUUUUUCAUUUUUUAAUUUAUUUUCUGUUUGGCCUCAUAUAUGCUUUCUAAAACAUACAGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications