Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378g URS000018E6CD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-378g: Hsa-mir-378g is a microRNA (miRNA) that has been analyzed in various studies. It has been identified as one of the significantly upregulated miRNAs in miRNA-Seq data sets [PMC4822037]. Previous studies have shown that hsa-mir-378g is involved in the proliferation, invasion, and metastasis of cancers [PMC6267165]. It has also been identified as a dysregulated miRNA targeting MX1, OASL, RNF2, and UST [PMC5977984]. Hsa-mir-378g has been selected as a candidate biomarker for predicting individual response to TG tablets [PMC5977984]. It plays a key role in the miRNA-target gene co-expression network and miRNA-mediated gene signal transduction network [PMC5977984]. In an independent test validation, the expression levels of hsa-mir-378g were used to validate an SVM-based model for predicting drug response [PMC5977984]. The putative target gene of hsa-mir-378g is UST, which is involved in Chondroitin sulfate/dermatan sulfate metabolism and Glycosaminoglycan metabolism [PMC5977984]. Hsa-mir-378g also contains binding sites for CILP 3'UTR and may be involved in regulating oxidative stress by targeting various genes such as ATG12, ANPEP, MAPK3, or EREG [PMC8261929] and IL10, MMP2 or CREB [PMC7595655]. Overall, hsa-mir-378g is an important miRNA that plays a role in cancer progression and drug response prediction.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGGCUUGGAGUCAGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications