Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus tomentosa Pto-miR159b URS00001834B5_118781

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGAUUGAAGGGAGCUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Allium sativum partial miR159a_1
  2. Amborella trichopoda atr-miR159
  3. Ananas comosus miR159d
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR159a-3p
  5. Arabidopsis thaliana ath-miR159a
  6. Arachis hypogaea ahy-miR159
  7. Asparagus officinalis (garden asparagus) aof-miR159
  8. Brassica napus bna-miR159
  9. Brassica rapa bra-miR159a
  10. Carica papaya (papaya) cpa-miR159a
  11. Citrus sinensis (sweet orange) csi-miR159a-3p
  12. Corchorus capsularis sRNA CCACVL1_25668
  13. Corchorus olitorius ahy-miR1
  14. Cucumis melo (muskmelon) cme-miR159a
  15. Cynara cardunculus var. scolymus cca-miR159a
  16. Fragaria vesca subsp. vesca fve-miR159a-3p
  17. Glycine max (soybean) gma-miR159a-3p
  18. Helianthus annuus ath-miR159a
  19. Helianthus tuberosus (Jerusalem artichoke) htu-miR159a
  20. Hevea brasiliensis hbr-miR159a
  21. Malus domestica mdm-miR159e
  22. Manihot esculenta mes-miR159a-3p
  23. Medicago truncatula (barrel medic) mtr-miR159a
  24. Nicotiana tabacum nta-miR159
  25. Phaseolus vulgaris (string bean) pvu-miR159a.1
  26. Populus trichocarpa (black cottonwood) ptc-miR159b
  27. Prunus persica (peach) ppe-miR159
  28. Ricinus communis rco-miR159
  29. Solanum lycopersicum sly-miR159
  30. Vitis vinifera (wine grape) vvi-miR159c
  31. Vriesea carinata vca-miR159-3p