Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8345116 URS000016B3AD_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGGCAAUGGUAGAACUCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Anolis carolinensis aca-miR-182-5p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-182
  3. Callorhinchus milii (elephant shark) eshark_mir-182_1
  4. Danio rerio (zebrafish) dre-miR-182-5p
  5. Gadus morhua (Atlantic cod) gmo-miR-182-5p
  6. Gorilla gorilla (western gorilla) ggo-miR-182
  7. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-182
  8. Ictalurus punctatus ipu-miR-182
  9. Macaca mulatta (Rhesus monkey) mml-miR-182
  10. Maylandia zebra mze-miR-182
  11. Monodelphis domestica mdo-miR-182-5p
  12. Neolamprologus brichardi (lyretail cichlid) nbr-miR-182
  13. Oreochromis niloticus (Nile tilapia) oni-miR-182
  14. Ornithorhynchus anatinus oan-miR-182-5p
  15. Paralichthys olivaceus pol-miR-182-5p
  16. Pongo pygmaeus ppy-miR-182
  17. Pundamilia nyererei pny-miR-182
  18. Salmo salar (Atlantic salmon) ssa-miR-182-5p
  19. Sarcophilus harrisii Sha-Mir-96-P2_5p (mature (guide))
  20. Tor tambroides (Thai mahseer) miR-182-5p
  21. Xenopus tropicalis (tropical clawed frog) xtr-miR-182-5p