Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cercopithecus diana (Diana monkey) tRNA-Met secondary structure diagram

Cercopithecus diana (Diana monkey) tRNA-Met URS00001514AC_36224

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUACACCCUUCCCGUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Homo sapiens (human) tRNA-Met
  2. Hylobates lar tRNA-Met
  3. Hylobates muelleri (Mueller's Borneo gibbon) tRNA-Met
  4. Hylobates pileatus (pileated gibbon) tRNA-Met
  5. Nomascus concolor (Black crested gibbon) tRNA-Met
  6. Nomascus gabriellae tRNA-Met
  7. Nomascus leucogenys tRNA-Met
  8. Nomascus siki (southern white-cheeked gibbon) tRNA-Met
  9. Pan troglodytes (chimpanzee) tRNA (ENSPTRG00000042652.1)
  10. Pan troglodytes verus tRNA-Met
  11. Plecotus macrobullaris tRNA-Met
  12. Pongo pygmaeus (Bornean orangutan) tRNA-Met
  13. Rhinopithecus strykeri tRNA-Met
2D structure