Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 29 (SNORA29) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 29 (SNORA29) URS000014DCD2_9606

  • 140 nucleotides
  • 9 databases (ENA, Ensembl, GeneCards, HUGO Gene Nomenclature Committee, MalaCards, RefSeq, RFAM, snoDB, snOPY)
  • Found in 1 other species
  • 16 publications
  • snoRNA
Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

snora29: SNORA29 is a small nucleolar RNA (snoRNA) that is implicated in the modification of ribosomal RNA (rRNA) and is highly conserved across vertebrate species [PMC8609340]. In humans, SNORA29 is typically found in a partially processed lariat form, and mutations in the human SNORA29 sequence, particularly in the conserved ACA box, may affect its function as a guide RNA [PMC8609340]. Despite its conservation, SNORA29 expression levels are significantly lower in human brain tissue compared to other species such as mice, macaques, and chimpanzees [PMC4824147]. This reduced expression may be attributed to two human-specific mutations that destabilize the secondary structure of SNORA29 [PMC4824147]. Interestingly, these mutations are shared with Neanderthals and Denisovans and are thought to have occurred within the last 6-8 million years of human evolution [PMC4824147]. The low levels of mature SNORA29 expression do not appear to be due to changes in its host gene's expression but rather due to these destabilizing mutations [PMC4824147]. Despite being an orphan snoRNA with no known targets for modification, SNORA29's drastic change in expression levels on the human lineage suggests it may have contributed to unique functional features during human evolution [PMC4824147][PMC6984369].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCUCAUUUGACUACCACAUUUUCUCCUAAUAAUAGAUUUUAGUGGCUAUGCUUAUGGGAUAGAUUAAACUUGCCAUGAUCUGAAGAGGGAGGGUUUUUUCAUGUCCUCCUCCUAUAUGAAAUGGCUGAACGGAUAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications