Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-342-3p URS0000148B91_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCACACAGAAAUCGCACCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris (dog) cfa-miR-342
  2. Gallus gallus Gallus_gallus piRNA piR-gga-167195
  3. Homo sapiens (human) hsa-miR-342-3p
  4. Macaca mulatta mml-miR-342-3p
  5. Mus musculus (house mouse) mmu-miR-342-3p
  6. Pan troglodytes (chimpanzee) ptr-miR-342
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-342-3p
  8. Pteropus alecto (black flying fox) pal-miR-342-3p
  9. Rattus norvegicus rno-miR-342-3p
  10. Tupaia chinensis tch-miR-342-3p
Publications