Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Siganus canaliculatus (white-spotted rabbitfish) microRNA 17 URS0000130255_75042

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAAGUGCUUACAGUGCAGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) microRNA miR-17-5p
  2. Columba livia (rock pigeon) cli-miR-17-5p
  3. Danio rerio (zebrafish) dre-miR-17a-5p
  4. Gadus morhua gmo-miR-17-5p
  5. Haplochromis burtoni abu-miR-17
  6. Maylandia zebra mze-miR-17
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-5935422
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-17
  9. Oreochromis niloticus oni-miR-17a
  10. Ovis aries oar-miR-17-5p
  11. Pundamilia nyererei pny-miR-17
  12. Python bivittatus (Burmese python) pbv-miR-17-5p
  13. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-62922
  14. Takifugu rubripes (torafugu) fru-miR-17
  15. Tetraodon nigroviridis tni-miR-17
  16. Tor tambroides miR-17a-5p
  17. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3390099