Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-548aa URS000012930C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-548aa: hsa-mir-548aa is a microRNA (miRNA) that has been identified through intersection analysis with other differentially expressed miRNAs in anaplastic thyroid carcinoma (ATC) patients, although it was not significantly overexpressed in comparison to normal controls [PMC9904904]. This miRNA, along with hsa-mir-548d, is located on opposite strands of the same genomic region and has the potential to form a miRNA:miRNA duplex through complementary binding [PMC3468316]. hsa-mir-548aa has been associated with various cancer types and was predicted to target the STK11 gene, which is implicated in cancer [PMC5629565; PMC7999775]. It is also listed among the top target miRNAs in a related study [PMC6414176]. Interestingly, hsa-mir-548aa shares an identical sequence with hsa-miR-548 t-3p as per their respective entries in the miRBase database and RNAcentral link [PMC8942954]. Additionally, it is among 26 identical miRNA targets shared by two circular RNAs (hsa_circ_0089761 and hsa_circ_0089763), suggesting potential regulatory roles or biomarker utility in cancer biology [PMC9441041].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAAACCACAAUUACUUUUGCACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications