Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Trp (UGA/G) (MT-TW) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Trp (UGA/G) (MT-TW) URS000012396D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mt-tw: MT-TW is a mitochondrial tRNA gene, specifically one of the 22 mt-tRNAs encoded on the mitochondrial genome's H-strand, which is essential for the proper translation of mitochondrial proteins [PMC9657367]. The m.5541C > T mutation in the MT-TW gene disrupts base pairing in the anticodon stem, leading to a T-G mismatch and consequently impairing the translation machinery for mitochondrial tryptophan [PMC4546323]. This mutation has been associated with a disease phenotype, as evidenced by a patient with MELAS syndrome showing multiple organ involvement and carrying this heteroplasmic mutation [PMC4546323]. Interestingly, MT-TW mutations exhibit a unique pattern of deficiencies in oxidative phosphorylation complexes, with complex IV showing a less severe deficiency compared to other mt-tRNA mutations [PMC4606788]. Despite its association with disease, statistical analysis suggests that this particular gene's mutation does not reach significance when considering multiple testing corrections [PMC4350597].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAAUUUAGGUUAAAUACAGACCAAGAGCCUUCAAAGCCCUCAGUAAGUUGCAAUACUUAAUUUCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Homo heidelbergensis tRNA-Trp
  2. Homo sapiens neanderthalensis transfer RNA-Trp
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications