Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-101 URS00001230A0_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-101: Bta-mir-101 is a differentially expressed (DE) bovine microRNA (miRNA) that has been studied in various contexts. In a study analyzing DE-bta-miRNAs, bta-mir-101 was found to have a log fold change (LogFC) value below 2, indicating downregulation [PMC9437019]. Another study observed that bta-mir-101 may potentially silence the expression of ARG2 in infected cells [PMC7020904]. Additionally, bta-mir-101 was identified as a potential regulatory target for immune genes such as ARG2, BCL2A1, TMEM173, and STAT1 [PMC7020904]. In the context of pregnancy in cows, bta-mir-101 was found to have different abundance levels between pregnant and non-pregnant cows [PMC5662615]. Furthermore, in cows with metritis compared to healthy cows, bta-mir-101 was downregulated [PMC7832875]. Bta-mir-101 was also identified as one of the DE miRNAs targeting genes predicted by RNAhybrid analysis and SOAP analysis in milk exosomes between uninfected and infected animals [PMC4609085]. In terms of expression levels across different cattle breeds and tissues such as liver tissue in Angus steers and Holstein dairy cows, bta-mir-101 consistently showed high expression levels along with other miRNAs [PMC7653039].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUACUGUGAUAACUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-101-2
  2. Columba livia cli-miR-101-3p
  3. Equus caballus (horse) eca-miR-101
  4. Homo sapiens (human) hsa-miR-101-3p
  5. Mus musculus (house mouse) mmu-miR-101a-3p
  6. Pongo pygmaeus ppy-miR-101
  7. Rattus norvegicus (Norway rat) rno-miR-101a-3p
  8. Sus scrofa ssc-miR-101
  9. Xenopus laevis xla-miR-101a
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2499796
Publications