Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-206 precursor URS000011F674_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-206: Mmu-mir-206 is a microRNA that is found in mice [PMC4383946]. It has the same sequence as hsa-miR-206, which is found in humans [PMC4383946]. Mmu-mir-206 has been shown to be positively regulated by IGF1 treatment in combination with MAPK/ERK-inhibitor treatment, along with other myogenic markers [PMC4325962]. However, the downregulation of mmu-mir-206 by TNF-α was diminished when a MAPK/ERK inhibitor was applied, and myogenic marker expression was unaffected [PMC4325962]. The effect on miRNA processing seems to be miRNA-specific and precursor-specific [PMC4325962]. Mmu-mir-206 has been found to be inhibited by Rb1 treatment, with the most significant inhibitory effect on mmu-miR-134 [PMC9120625]. Mmu-mir-206 has also been associated with other genes and transcription factors after ovariectomy and orchiectomy in mice [PMC7074395]. The expression of mmu-mir-206 increases progressively with time of embryonic development in mice [PMC1635289]. It has also been shown to be involved in muscle cell differentiation and is associated with specific target genes such as Ezh2, Epha2, and Gja1 [PMC3753644]. The expression levels of mmu-mir-206 vary depending on age and muscle type in mice [PMC6250799]. TargetScanFish 6.2, TargetScan 7.2, and TargetScanMouse 7.2 have been used to analyze dre-miR-206-3p, hsa-miR-206, and mmu-mir-206 respectively[ PMC8055004]. In situ hybridization using a locked nucleic acid (LNA) detection probe has been performed to detect mmu-mir-206 [PMC3422271]. The levels of mmu-mir-206 can be inhibited or overexpressed using specific inhibitors or constructs [PMC3973319]. The numbers of constructs encoding mmu-mir-1-1, mmu-mir-1-2, and mmu-mir-206 in mice are 20, 6, and 6 respectively [PMC2613404].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGGCCACAUGCUUCUUUAUAUCCUCAUAGAUAUCUCAGCACUAUGGAAUGUAAGGAAGUGUGUGGUUUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications