v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) tRNA (ENSGGOG00000024031.1) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) tRNA (ENSGGOG00000024031.1) URS000011A084_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGAGUGUAGCUUAACACAAAGCACCCAACUUACACUUAGGAGAUUUCAACUCAACUUGACCGCUCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla beringei (eastern gorilla) tRNA-Val
  2. Gorilla beringei graueri (eastern lowland gorilla) tRNA-Val
  3. Gorilla gorilla (western gorilla) tRNA-Val
  4. Homo sapiens (human) tRNA-Val
 2D structure