Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Myotis lucifugus (little brown bat) mir-19 microRNA precursor family URS0000116775_59463

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Ailuropoda melanoleuca mir-19
  2. Ateles geoffroyi (black-handed spider monkey) mir-19 microRNA precursor family
  3. Bos taurus (cattle) mir-19 microRNA precursor family
  4. Callithrix jacchus (white-tufted-ear marmoset) mir-19 microRNA precursor family
  5. Camelus ferus mir-19 microRNA precursor family
  6. Canis lupus familiaris (dog) mir-19 microRNA precursor family
  7. Cavia porcellus mir-19 microRNA precursor family
  8. Chlorocebus sabaeus mir-19 microRNA precursor family
  9. Dipodomys ordii mir-19 microRNA precursor family
  10. Erinaceus europaeus (western European hedgehog) mir-19 microRNA precursor family
  11. Felis catus mir-19 microRNA precursor family
  12. Fukomys damarensis mir-19 microRNA precursor family
  13. Gorilla gorilla gorilla mir-19 microRNA precursor family
  14. Heterocephalus glaber (naked mole-rat) mir-19 microRNA precursor family
  15. Homo sapiens mir-19 microRNA precursor family
  16. Lagothrix lagotricha (brown woolly monkey) mir-19 microRNA precursor family
  17. Loxodonta africana (African savanna elephant) mir-19 microRNA precursor family
  18. Marmota monax (woodchuck) non-coding RNA
  19. Myotis brandtii mir-19 microRNA precursor family
  20. Myotis davidii mir-19 microRNA precursor family
  21. Oryctolagus cuniculus (rabbit) mir-19 microRNA precursor family
  22. Otolemur garnettii mir-19 microRNA precursor family
  23. Ovis aries mir-19 microRNA precursor family
  24. Pan troglodytes mir-19 microRNA precursor family
  25. Papio anubis (Olive baboon) mir-19 microRNA precursor family
  26. Pongo abelii (Sumatran orangutan) mir-19 microRNA precursor family
  27. Pteropus alecto (black flying fox) mir-19 microRNA precursor family
  28. Saguinus labiatus (red-chested mustached tamarin) mir-19 microRNA precursor family
  29. Ictidomys tridecemlineatus mir-19 microRNA precursor family
  30. Sus scrofa mir-19 microRNA precursor family
  31. Tupaia chinensis mir-19 microRNA precursor family
Publications