Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR1432-5p URS00001099DE_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR1432-5p: Osa-mir1432-5p is an upregulated miRNA in susceptible plants infected with rice stripe virus [PMC5897953]. It is suggested to be regulated under abiotic or biotic stresses [PMC4723043]. In a study comparing shoot and root miRNA expression, osa-mir1432-5p exhibited an opposite expression pattern in the shoot and root [PMC5249095]. In another study, osa-mir1432-5p was notably induced to higher levels after being challenged with Xoo strain [PMC7037501]. Additionally, osa-mir1432-5p was one of the miRNAs measured at multiple treatment time points and showed altered expression levels [PMC7037501]. In a comparison of CS and FLS datasets, osa-mir1432-5p displayed an inverse expression pattern [PMC9597502].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAGGAGAGAUGACACCGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR1432-5p
Publications