Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR168a-5p URS000010419E_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR168a-5p: Osa-mir168a-5p is a highly expressed miRNA that is encoded on the 5' arm of the precursor osa-MIR168a [PMC6246748]. It has been found to be involved in mediating the OsPTR29 cleavage pattern [PMC6043990]. Osa-mir168a-5p forms a short duplex with a specific sequence, fulfilling the "2-nt 3' overhang" criterion [PMC6246748]. It is expressed at the highest level within the 5'-armed cluster [PMC6246748]. Osa-mir168a-5p has been found to be highly expressed in hybrid and its parents [PMC9549252]. It is also highly expressed in certain lines, while osa-miR168b is undetected [PMC4570225]. Osa-mir168a-5p, along with other miRNAs, has been identified as a heat-responsive miRNA that can differentially alter gene expression by targeting specific HSF or HSP targets [PMC9136941]. It is one of the most abundantly expressed conserved miRNAs in certain conditions and lines [PMC9960954, PMC5578646]. Osa-mir168a-5p has been found to negatively regulate its target HSFB-2c and its expression pattern can be influenced by priming and HTS conditions [PMC8067039]. In certain datasets and conditions, osa-mir168a-5p shows changes in expression levels or inverse correlation with its target transcripts [PMC8067039, PMC5023111, PMC6042804, PMC9597502, PMC7539525].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGCUUGGUGCAGAUCGGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Aegilops tauschii ata-miR168-5p
  2. Brachypodium distachyon (stiff brome) bdi-miR168-5p
  3. Hordeum vulgare (barley) hvu-miR168-5p
  4. Oryza sativa Japonica Group microRNA osa-miR168a-5p
  5. Saccharum officinarum (sugarcane) sof-miR168a
  6. Saccharum sp. ssp-miR168a
  7. Sorghum bicolor sbi-miR168
  8. Zea mays (maize) zma-miR168a-5p
Publications