Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo abelii (Sumatran orangutan) Small nucleolar RNA SNORD115 (ENSPPYG00000037352.1, ENSPPYG00000039342.1, ENSPPYG00000040059.1) secondary structure diagram

Pongo abelii (Sumatran orangutan) Small nucleolar RNA SNORD115 (ENSPPYG00000037352.1, ENSPPYG00000039342.1, ENSPPYG00000040059.1) URS00000F2AEF_9601

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUCAAUGAUGAGAACCUUAUAUUGUCCUGAAGAGAGGUGAUGACUUAAAAAUCAUGCUCAAUAGGAUUACGCUGAGGCCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Aotus nancymaae Small nucleolar RNA SNORD115 (ENSANAG00000013800.1)
  2. Callithrix jacchus Small nucleolar RNA SNORD115 (ENSCJAG00000086051.1)
  3. Cebus imitator (Panamanian white-faced capuchin) Small nucleolar RNA SNORD115 (ENSCCAG00000007210.1, ENSCCAG00000007227.1, ENSCCAG00000007342.1)
  4. Cercocebus atys (Sooty mangabey) Small nucleolar RNA SNORD115 (ENSCATG00000000544.1)
  5. Chlorocebus sabaeus (African green monkey) Small nucleolar RNA SNORD115 (multiple genes)
  6. Colobus angolensis palliatus (Angola colobus) Small nucleolar RNA SNORD115 (ENSCANG00000000770.1)
  7. Gorilla gorilla gorilla (Western Lowland Gorilla) Small nucleolar RNA SNORD115 (ENSGGOG00000039714.1)
  8. Homo sapiens (human) small nucleolar RNA, C/D box 115-11 (SNORD115-11, SNORD115-29, SNORD115-36, SNORD115-43)
  9. Macaca fascicularis Small nucleolar RNA SNORD115 (multiple genes)
  10. Macaca mulatta Small nucleolar RNA SNORD115 (multiple genes)
  11. Macaca nemestrina (Pig-tailed macaque) Small nucleolar RNA SNORD115 (ENSMNEG00000006575.1)
  12. Mandrillus leucophaeus Small nucleolar RNA SNORD115 (ENSMLEG00000001794.1, ENSMLEG00000005829.1)
  13. Nomascus leucogenys Small nucleolar RNA SNORD115 (ENSNLEG00000033066.1)
  14. Pan paniscus (bonobo) Small nucleolar RNA SNORD115 (ENSPPAG00000012698.1)
  15. Pan troglodytes (chimpanzee) Small nucleolar RNA SNORD115 (ENSPTRG00000047804.1)
  16. Papio anubis (olive baboon) Small nucleolar RNA SNORD115 (multiple genes)
  17. Piliocolobus tephrosceles Small nucleolar RNA SNORD115 (ENSPTEG00000039009.1)
  18. Rhinopithecus bieti Small nucleolar RNA SNORD115 (ENSRBIG00000003356.1)
  19. Rhinopithecus roxellana (Golden snub-nosed monkey) Small nucleolar RNA SNORD115 (ENSRROG00000023615.1)
  20. Saimiri boliviensis boliviensis Small nucleolar RNA SNORD115 (ENSSBOG00000012862.1)
  21. Theropithecus gelada Small nucleolar RNA SNORD115 (ENSTGEG00000021576.1)
2D structure Publications